Incidental Mutation 'R6558:Myadm'
ID522248
Institutional Source Beutler Lab
Gene Symbol Myadm
Ensembl Gene ENSMUSG00000068566
Gene Namemyeloid-associated differentiation marker
SynonymsD7Wsu62e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6558 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location3289080-3300442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3297061 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 113 (I113N)
Ref Sequence ENSEMBL: ENSMUSP00000145120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096744] [ENSMUST00000164553] [ENSMUST00000203328] [ENSMUST00000203566] [ENSMUST00000204541]
Predicted Effect probably damaging
Transcript: ENSMUST00000096744
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094505
Gene: ENSMUSG00000068566
AA Change: I113N

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 7.2e-16 PFAM
Pfam:MARVEL 162 311 1.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164553
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131318
Gene: ENSMUSG00000068566
AA Change: I113N

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203328
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144984
Gene: ENSMUSG00000068566
AA Change: I113N

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203566
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145120
Gene: ENSMUSG00000068566
AA Change: I113N

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203600
Predicted Effect probably benign
Transcript: ENSMUST00000204541
SMART Domains Protein: ENSMUSP00000145426
Gene: ENSMUSG00000068566

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 81 4.3e-9 PFAM
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 20,963,673 V161A probably damaging Het
Anxa3 A G 5: 96,812,939 probably null Het
Cftr T C 6: 18,222,528 I261T probably damaging Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Cog2 T C 8: 124,550,232 L659P probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cxcl2 T C 5: 90,904,365 L71P probably damaging Het
Cxcl5 A G 5: 90,759,818 E83G probably damaging Het
Dpt A G 1: 164,796,811 Y27C unknown Het
Drc3 A T 11: 60,364,892 I102F probably damaging Het
Fam83h T C 15: 76,004,453 D345G probably damaging Het
Gm14412 G T 2: 177,314,554 T516K probably damaging Het
Grip1 A G 10: 119,454,383 N7D probably benign Het
Hoxc11 T C 15: 102,954,866 L114P probably damaging Het
Htr7 T C 19: 36,057,240 N5S probably damaging Het
Ifi208 C T 1: 173,683,023 T248I probably damaging Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Map7d1 G A 4: 126,232,909 A798V unknown Het
Mfsd13a T A 19: 46,366,478 N31K probably damaging Het
Myo18a A G 11: 77,850,852 E1509G probably damaging Het
Nalcn C G 14: 123,486,507 R382P probably benign Het
Ogfr C T 2: 180,595,404 P594L possibly damaging Het
Olfr458 T A 6: 42,460,777 M81L probably benign Het
Olfr508 T A 7: 108,630,188 H65Q probably damaging Het
Pkd1l1 C T 11: 8,889,052 M877I probably benign Het
Sec23a A T 12: 59,004,552 S102T probably benign Het
Stoml1 T A 9: 58,256,668 V90E probably damaging Het
Stra8 G A 6: 34,933,040 W111* probably null Het
Timeless T A 10: 128,249,563 V850D probably benign Het
Unc5c A T 3: 141,789,729 D453V probably damaging Het
Xdh T G 17: 73,893,713 T1138P possibly damaging Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Myadm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Myadm APN 7 3297223 missense possibly damaging 0.79
IGL01075:Myadm APN 7 3297246 missense probably damaging 1.00
IGL03342:Myadm APN 7 3296887 missense possibly damaging 0.93
R0005:Myadm UTSW 7 3297564 nonsense probably null
R0269:Myadm UTSW 7 3296757 missense unknown
R0413:Myadm UTSW 7 3296760 frame shift probably null
R0414:Myadm UTSW 7 3296760 frame shift probably null
R0666:Myadm UTSW 7 3297349 missense probably damaging 0.98
R3036:Myadm UTSW 7 3297543 missense probably benign
R4275:Myadm UTSW 7 3297102 missense probably benign 0.01
R4606:Myadm UTSW 7 3297400 nonsense probably null
R5764:Myadm UTSW 7 3297252 missense possibly damaging 0.93
R6835:Myadm UTSW 7 3297676 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCAGCTAATATCCACCTGTGTG -3'
(R):5'- AAAACTTTGAGCAGCCCTGG -3'

Sequencing Primer
(F):5'- CAGTGTGGGTGCCTGGAC -3'
(R):5'- GCACGGTAGCCATATAGCCAG -3'
Posted On2018-06-06