Incidental Mutation 'R6530:Gm9047'
ID522263
Institutional Source Beutler Lab
Gene Symbol Gm9047
Ensembl Gene ENSMUSG00000090685
Gene Namepredicted gene 9047
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6530 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29471437-29473465 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 29471951 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004396] [ENSMUST00000149646] [ENSMUST00000171317]
Predicted Effect probably benign
Transcript: ENSMUST00000004396
SMART Domains Protein: ENSMUSP00000004396
Gene: ENSMUSG00000004285

DomainStartEndE-ValueType
Pfam:ATP-synt_F 8 109 2.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143101
SMART Domains Protein: ENSMUSP00000116986
Gene: ENSMUSG00000004285

DomainStartEndE-ValueType
Pfam:ATP-synt_F 31 90 6.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149646
SMART Domains Protein: ENSMUSP00000145062
Gene: ENSMUSG00000004285

DomainStartEndE-ValueType
Pfam:ATP-synt_F 3 61 7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159482
Predicted Effect probably null
Transcript: ENSMUST00000171317
SMART Domains Protein: ENSMUSP00000127891
Gene: ENSMUSG00000090685

DomainStartEndE-ValueType
low complexity region 58 83 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,588,695 L74P possibly damaging Het
Adamtsl4 T C 3: 95,681,054 T575A probably benign Het
Adck5 T G 15: 76,593,847 D224E probably benign Het
Asic4 A G 1: 75,472,335 N376S probably damaging Het
Atl3 T A 19: 7,522,134 D254E probably benign Het
Cacnb2 G T 2: 14,975,167 A274S probably damaging Het
Car2 T C 3: 14,896,731 V159A probably benign Het
Ccdc138 G C 10: 58,544,968 G474R probably damaging Het
Coq7 T C 7: 118,525,335 T203A probably benign Het
Dnah12 T C 14: 26,735,710 I877T probably damaging Het
Dnah7a C T 1: 53,503,697 R2438H probably benign Het
Efhc1 T A 1: 20,961,142 probably null Het
Fbn1 G A 2: 125,389,270 R459C probably damaging Het
Fer1l4 A G 2: 156,047,865 probably null Het
Gm38394 A G 1: 133,659,201 S133P probably damaging Het
Gm5114 G A 7: 39,408,090 P702S probably damaging Het
Inpp5f T A 7: 128,664,078 Y182* probably null Het
Irf6 C T 1: 193,157,349 T44M probably damaging Het
Loxhd1 A G 18: 77,412,151 N87S probably benign Het
Mtrf1 A T 14: 79,402,891 Q162L possibly damaging Het
Myoz3 G T 18: 60,579,520 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Olfr1065 A C 2: 86,445,482 S167A probably benign Het
Parg T C 14: 32,209,199 S176P probably damaging Het
Prdm2 A C 4: 143,134,047 V891G probably benign Het
Rasl10a T A 11: 5,058,367 I21N probably damaging Het
Reg4 T C 3: 98,224,832 V20A probably benign Het
Shprh T A 10: 11,194,267 S1462R probably benign Het
Sult1e1 T C 5: 87,576,288 E270G probably benign Het
Trpm7 A C 2: 126,812,711 F1436V probably damaging Het
Ttc33 A G 15: 5,212,122 probably null Het
Ucp2 A T 7: 100,498,223 E161D probably benign Het
Vmn2r79 T C 7: 87,002,044 F217S possibly damaging Het
Wdr93 G A 7: 79,755,993 A207T probably damaging Het
Zfp949 T C 9: 88,567,287 probably null Het
Other mutations in Gm9047
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02958:Gm9047 APN 6 29471626 missense probably damaging 1.00
IGL03213:Gm9047 APN 6 29471793 missense probably damaging 0.96
R0511:Gm9047 UTSW 6 29478170 unclassified probably benign
R2404:Gm9047 UTSW 6 29473391 missense probably benign 0.02
R5943:Gm9047 UTSW 6 29471909 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAAAACTGCCCACCCTGTTG -3'
(R):5'- AATGATCCGGCTGAAGCACAC -3'

Sequencing Primer
(F):5'- AGAGCCTCTTTTTCTGTCAGATATG -3'
(R):5'- GCACACGCTTCCCCACC -3'
Posted On2018-06-06