Incidental Mutation 'R6530:Wdr93'
ID522267
Institutional Source Beutler Lab
Gene Symbol Wdr93
Ensembl Gene ENSMUSG00000039099
Gene NameWD repeat domain 93
SynonymsEG626359
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R6530 (G1)
Quality Score221.009
Status Validated
Chromosome7
Chromosomal Location79743163-79785950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79755993 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 207 (A207T)
Ref Sequence ENSEMBL: ENSMUSP00000037467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035622]
Predicted Effect probably damaging
Transcript: ENSMUST00000035622
AA Change: A207T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037467
Gene: ENSMUSG00000039099
AA Change: A207T

DomainStartEndE-ValueType
low complexity region 240 251 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
SCOP:d1jofa_ 389 607 7e-4 SMART
Blast:WD40 413 451 2e-11 BLAST
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,588,695 L74P possibly damaging Het
Adamtsl4 T C 3: 95,681,054 T575A probably benign Het
Adck5 T G 15: 76,593,847 D224E probably benign Het
Asic4 A G 1: 75,472,335 N376S probably damaging Het
Atl3 T A 19: 7,522,134 D254E probably benign Het
Cacnb2 G T 2: 14,975,167 A274S probably damaging Het
Car2 T C 3: 14,896,731 V159A probably benign Het
Ccdc138 G C 10: 58,544,968 G474R probably damaging Het
Coq7 T C 7: 118,525,335 T203A probably benign Het
Dnah12 T C 14: 26,735,710 I877T probably damaging Het
Dnah7a C T 1: 53,503,697 R2438H probably benign Het
Efhc1 T A 1: 20,961,142 probably null Het
Fbn1 G A 2: 125,389,270 R459C probably damaging Het
Fer1l4 A G 2: 156,047,865 probably null Het
Gm38394 A G 1: 133,659,201 S133P probably damaging Het
Gm5114 G A 7: 39,408,090 P702S probably damaging Het
Gm9047 G A 6: 29,471,951 probably null Het
Inpp5f T A 7: 128,664,078 Y182* probably null Het
Irf6 C T 1: 193,157,349 T44M probably damaging Het
Loxhd1 A G 18: 77,412,151 N87S probably benign Het
Mtrf1 A T 14: 79,402,891 Q162L possibly damaging Het
Myoz3 G T 18: 60,579,520 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Olfr1065 A C 2: 86,445,482 S167A probably benign Het
Parg T C 14: 32,209,199 S176P probably damaging Het
Prdm2 A C 4: 143,134,047 V891G probably benign Het
Rasl10a T A 11: 5,058,367 I21N probably damaging Het
Reg4 T C 3: 98,224,832 V20A probably benign Het
Shprh T A 10: 11,194,267 S1462R probably benign Het
Sult1e1 T C 5: 87,576,288 E270G probably benign Het
Trpm7 A C 2: 126,812,711 F1436V probably damaging Het
Ttc33 A G 15: 5,212,122 probably null Het
Ucp2 A T 7: 100,498,223 E161D probably benign Het
Vmn2r79 T C 7: 87,002,044 F217S possibly damaging Het
Zfp949 T C 9: 88,567,287 probably null Het
Other mutations in Wdr93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Wdr93 APN 7 79775553 missense probably damaging 1.00
IGL01910:Wdr93 APN 7 79771573 missense probably damaging 1.00
IGL01977:Wdr93 APN 7 79752505 missense probably damaging 1.00
IGL01979:Wdr93 APN 7 79776652 missense probably benign 0.03
IGL02191:Wdr93 APN 7 79749220 missense probably damaging 0.98
R0008:Wdr93 UTSW 7 79758473 missense probably damaging 1.00
R0008:Wdr93 UTSW 7 79758473 missense probably damaging 1.00
R1136:Wdr93 UTSW 7 79773448 missense probably damaging 1.00
R1168:Wdr93 UTSW 7 79749174 missense probably damaging 0.99
R1586:Wdr93 UTSW 7 79768361 missense probably damaging 0.99
R1605:Wdr93 UTSW 7 79771509 splice site probably null
R1651:Wdr93 UTSW 7 79750082 missense probably benign 0.00
R3078:Wdr93 UTSW 7 79752493 missense possibly damaging 0.81
R3689:Wdr93 UTSW 7 79771585 missense possibly damaging 0.91
R4013:Wdr93 UTSW 7 79768411 missense possibly damaging 0.90
R4771:Wdr93 UTSW 7 79776763 missense probably damaging 0.99
R4824:Wdr93 UTSW 7 79750069 nonsense probably null
R4887:Wdr93 UTSW 7 79785774 missense probably damaging 1.00
R5172:Wdr93 UTSW 7 79752493 missense probably damaging 0.97
R5510:Wdr93 UTSW 7 79750031 missense probably damaging 1.00
R5625:Wdr93 UTSW 7 79771018 missense probably benign 0.00
R5648:Wdr93 UTSW 7 79777226 missense probably benign 0.04
R5950:Wdr93 UTSW 7 79773431 missense probably damaging 0.99
R6147:Wdr93 UTSW 7 79758497 missense probably benign
R7056:Wdr93 UTSW 7 79749340 missense probably damaging 1.00
R7079:Wdr93 UTSW 7 79749292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCTTCTGGAAGACCCG -3'
(R):5'- GGGCAGTGTCACTATTCCTG -3'

Sequencing Primer
(F):5'- TTCTGGAAGACCCGTGTCCTG -3'
(R):5'- TGTTAGATCCTCTGGAACGACAG -3'
Posted On2018-06-06