Incidental Mutation 'R6530:Ucp2'
ID 522271
Institutional Source Beutler Lab
Gene Symbol Ucp2
Ensembl Gene ENSMUSG00000033685
Gene Name uncoupling protein 2 (mitochondrial, proton carrier)
Synonyms
MMRRC Submission 044656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R6530 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 100142565-100148832 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100147430 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 161 (E161D)
Ref Sequence ENSEMBL: ENSMUSP00000146337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126534] [ENSMUST00000129324] [ENSMUST00000133044] [ENSMUST00000207748] [ENSMUST00000154516] [ENSMUST00000153287] [ENSMUST00000207405]
AlphaFold P70406
Predicted Effect probably benign
Transcript: ENSMUST00000054923
SMART Domains Protein: ENSMUSP00000059074
Gene: ENSMUSG00000030708

DomainStartEndE-ValueType
DnaJ 3 60 3.52e-23 SMART
Pfam:DnaJ_C 140 299 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126381
Predicted Effect probably benign
Transcript: ENSMUST00000126534
AA Change: E161D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120967
Gene: ENSMUSG00000033685
AA Change: E161D

DomainStartEndE-ValueType
Pfam:Mito_carr 10 111 1.3e-21 PFAM
Pfam:Mito_carr 112 208 2e-27 PFAM
Pfam:Mito_carr 211 302 5.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129324
SMART Domains Protein: ENSMUSP00000115648
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 65 8.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130534
Predicted Effect probably benign
Transcript: ENSMUST00000133044
AA Change: E161D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115598
Gene: ENSMUSG00000033685
AA Change: E161D

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 2.6e-23 PFAM
Pfam:Mito_carr 112 172 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133498
Predicted Effect probably benign
Transcript: ENSMUST00000207748
AA Change: E161D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149808
Predicted Effect probably benign
Transcript: ENSMUST00000154516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207890
Predicted Effect probably benign
Transcript: ENSMUST00000153287
SMART Domains Protein: ENSMUSP00000115953
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 6.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207405
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have elevated pancreatic islet cell ATP levels and increased glucose-stimulated secretion of insulin. Homozygotes also show reduced mitochondrial proton leak in thymocytes and increased resistance to infection by Toxoplasma gondii. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,746,039 (GRCm39) L74P possibly damaging Het
Adamtsl4 T C 3: 95,588,364 (GRCm39) T575A probably benign Het
Adck5 T G 15: 76,478,047 (GRCm39) D224E probably benign Het
Asic4 A G 1: 75,448,979 (GRCm39) N376S probably damaging Het
Atl3 T A 19: 7,499,499 (GRCm39) D254E probably benign Het
Cacnb2 G T 2: 14,979,978 (GRCm39) A274S probably damaging Het
Car2 T C 3: 14,961,791 (GRCm39) V159A probably benign Het
Ccdc138 G C 10: 58,380,790 (GRCm39) G474R probably damaging Het
Coq7 T C 7: 118,124,558 (GRCm39) T203A probably benign Het
Dnah12 T C 14: 26,456,865 (GRCm39) I877T probably damaging Het
Dnah7a C T 1: 53,542,856 (GRCm39) R2438H probably benign Het
Efhc1 T A 1: 21,031,366 (GRCm39) probably null Het
Fbn1 G A 2: 125,231,190 (GRCm39) R459C probably damaging Het
Fer1l4 A G 2: 155,889,785 (GRCm39) probably null Het
Gm5114 G A 7: 39,057,514 (GRCm39) P702S probably damaging Het
Inpp5f T A 7: 128,265,802 (GRCm39) Y182* probably null Het
Irf6 C T 1: 192,839,657 (GRCm39) T44M probably damaging Het
Loxhd1 A G 18: 77,499,847 (GRCm39) N87S probably benign Het
Mtrf1 A T 14: 79,640,331 (GRCm39) Q162L possibly damaging Het
Myoz3 G T 18: 60,712,592 (GRCm39) probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Nkd2 C T 13: 73,970,809 (GRCm39) G258R probably null Het
Or8k27 A C 2: 86,275,826 (GRCm39) S167A probably benign Het
Parg T C 14: 31,931,156 (GRCm39) S176P probably damaging Het
Prdm2 A C 4: 142,860,617 (GRCm39) V891G probably benign Het
Rasl10a T A 11: 5,008,367 (GRCm39) I21N probably damaging Het
Reg4 T C 3: 98,132,148 (GRCm39) V20A probably benign Het
Shprh T A 10: 11,070,011 (GRCm39) S1462R probably benign Het
Spmip1 G A 6: 29,471,950 (GRCm39) probably null Het
Sult1e1 T C 5: 87,724,147 (GRCm39) E270G probably benign Het
Trpm7 A C 2: 126,654,631 (GRCm39) F1436V probably damaging Het
Ttc33 A G 15: 5,241,603 (GRCm39) probably null Het
Vmn2r79 T C 7: 86,651,252 (GRCm39) F217S possibly damaging Het
Wdr93 G A 7: 79,405,741 (GRCm39) A207T probably damaging Het
Zbed6 A G 1: 133,586,939 (GRCm39) S133P probably damaging Het
Zfp949 T C 9: 88,449,340 (GRCm39) probably null Het
Other mutations in Ucp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Ucp2 APN 7 100,147,629 (GRCm39) missense probably benign
IGL02184:Ucp2 APN 7 100,148,529 (GRCm39) missense probably benign
IGL02370:Ucp2 APN 7 100,147,591 (GRCm39) missense probably damaging 0.96
IGL02449:Ucp2 APN 7 100,148,017 (GRCm39) missense probably damaging 1.00
R1808:Ucp2 UTSW 7 100,148,021 (GRCm39) missense probably damaging 0.97
R1809:Ucp2 UTSW 7 100,147,606 (GRCm39) missense probably damaging 0.98
R2384:Ucp2 UTSW 7 100,147,461 (GRCm39) missense probably benign
R2508:Ucp2 UTSW 7 100,147,620 (GRCm39) missense probably benign
R2866:Ucp2 UTSW 7 100,146,459 (GRCm39) missense probably benign 0.31
R4400:Ucp2 UTSW 7 100,148,557 (GRCm39) makesense probably null
R5022:Ucp2 UTSW 7 100,147,579 (GRCm39) missense possibly damaging 0.74
R6073:Ucp2 UTSW 7 100,147,338 (GRCm39) missense possibly damaging 0.96
R7381:Ucp2 UTSW 7 100,147,576 (GRCm39) missense possibly damaging 0.94
R7572:Ucp2 UTSW 7 100,146,514 (GRCm39) critical splice donor site probably null
R9377:Ucp2 UTSW 7 100,146,040 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTGGCAAGAGCATGATGC -3'
(R):5'- TCATAGGTCACCAGCTCAGC -3'

Sequencing Primer
(F):5'- CTGCGGGCCACTAACCC -3'
(R):5'- GCACAGTTGACAATGGCATTAC -3'
Posted On 2018-06-06