Incidental Mutation 'R6530:Atl3'
ID522302
Institutional Source Beutler Lab
Gene Symbol Atl3
Ensembl Gene ENSMUSG00000024759
Gene Nameatlastin GTPase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R6530 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7494040-7538608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7522134 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 254 (D254E)
Ref Sequence ENSEMBL: ENSMUSP00000132619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025668] [ENSMUST00000170373]
Predicted Effect probably benign
Transcript: ENSMUST00000025668
AA Change: D259E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025668
Gene: ENSMUSG00000024759
AA Change: D259E

DomainStartEndE-ValueType
Pfam:GBP 36 310 7.2e-99 PFAM
Pfam:GBP_C 312 438 1.7e-9 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170373
AA Change: D254E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132619
Gene: ENSMUSG00000024759
AA Change: D254E

DomainStartEndE-ValueType
Pfam:GBP 31 305 9.1e-98 PFAM
Pfam:GBP_C 307 433 7.4e-10 PFAM
transmembrane domain 439 461 N/A INTRINSIC
transmembrane domain 463 485 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of dynamin-like, integral membrane GTPases. The encoded protein is required for the proper formation of the network of interconnected tubules of the endoplasmic reticulum. Mutations in this gene may be associated with hereditary sensory neuropathy type IF. Alternatively spliced transcript variants that encode distinct isoforms have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,588,695 L74P possibly damaging Het
Adamtsl4 T C 3: 95,681,054 T575A probably benign Het
Adck5 T G 15: 76,593,847 D224E probably benign Het
Asic4 A G 1: 75,472,335 N376S probably damaging Het
Cacnb2 G T 2: 14,975,167 A274S probably damaging Het
Car2 T C 3: 14,896,731 V159A probably benign Het
Ccdc138 G C 10: 58,544,968 G474R probably damaging Het
Coq7 T C 7: 118,525,335 T203A probably benign Het
Dnah12 T C 14: 26,735,710 I877T probably damaging Het
Dnah7a C T 1: 53,503,697 R2438H probably benign Het
Efhc1 T A 1: 20,961,142 probably null Het
Fbn1 G A 2: 125,389,270 R459C probably damaging Het
Fer1l4 A G 2: 156,047,865 probably null Het
Gm38394 A G 1: 133,659,201 S133P probably damaging Het
Gm5114 G A 7: 39,408,090 P702S probably damaging Het
Gm9047 G A 6: 29,471,951 probably null Het
Inpp5f T A 7: 128,664,078 Y182* probably null Het
Irf6 C T 1: 193,157,349 T44M probably damaging Het
Loxhd1 A G 18: 77,412,151 N87S probably benign Het
Mtrf1 A T 14: 79,402,891 Q162L possibly damaging Het
Myoz3 G T 18: 60,579,520 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Olfr1065 A C 2: 86,445,482 S167A probably benign Het
Parg T C 14: 32,209,199 S176P probably damaging Het
Prdm2 A C 4: 143,134,047 V891G probably benign Het
Rasl10a T A 11: 5,058,367 I21N probably damaging Het
Reg4 T C 3: 98,224,832 V20A probably benign Het
Shprh T A 10: 11,194,267 S1462R probably benign Het
Sult1e1 T C 5: 87,576,288 E270G probably benign Het
Trpm7 A C 2: 126,812,711 F1436V probably damaging Het
Ttc33 A G 15: 5,212,122 probably null Het
Ucp2 A T 7: 100,498,223 E161D probably benign Het
Vmn2r79 T C 7: 87,002,044 F217S possibly damaging Het
Wdr93 G A 7: 79,755,993 A207T probably damaging Het
Zfp949 T C 9: 88,567,287 probably null Het
Other mutations in Atl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02667:Atl3 APN 19 7509416 missense possibly damaging 0.72
R0042:Atl3 UTSW 19 7529023 missense probably damaging 1.00
R0607:Atl3 UTSW 19 7529666 critical splice donor site probably null
R0975:Atl3 UTSW 19 7521135 nonsense probably null
R1582:Atl3 UTSW 19 7516899 missense probably damaging 1.00
R4195:Atl3 UTSW 19 7518546 missense possibly damaging 0.59
R4249:Atl3 UTSW 19 7532338 missense probably benign 0.06
R4505:Atl3 UTSW 19 7520819 missense probably benign 0.00
R4836:Atl3 UTSW 19 7509545 nonsense probably null
R5649:Atl3 UTSW 19 7532227 missense possibly damaging 0.50
R5721:Atl3 UTSW 19 7529011 missense probably benign 0.00
R6459:Atl3 UTSW 19 7520798 missense probably benign 0.07
R6543:Atl3 UTSW 19 7510098 missense probably damaging 1.00
R6550:Atl3 UTSW 19 7522138 missense probably benign
R7059:Atl3 UTSW 19 7533968 missense probably benign
R7059:Atl3 UTSW 19 7533969 missense probably benign 0.08
X0020:Atl3 UTSW 19 7530569 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTGATCTGTCATTTGGGAAG -3'
(R):5'- TCAGGAGGGAAATCTGAACTGTAC -3'

Sequencing Primer
(F):5'- CTGATCTGTCATTTGGGAAGTCTTC -3'
(R):5'- GAGGGAAATCTGAACTGTACTAATAC -3'
Posted On2018-06-06