Incidental Mutation 'R6564:Mccc1'
ID522306
Institutional Source Beutler Lab
Gene Symbol Mccc1
Ensembl Gene ENSMUSG00000027709
Gene Namemethylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
Synonyms2310058B18Rik, MCCA, MCCalpha, 1810045E08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R6564 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location35959312-36000678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35976676 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 414 (T414A)
Ref Sequence ENSEMBL: ENSMUSP00000029259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029259] [ENSMUST00000199113] [ENSMUST00000200163]
Predicted Effect probably damaging
Transcript: ENSMUST00000029259
AA Change: T414A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029259
Gene: ENSMUSG00000027709
AA Change: T414A

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 4.7e-50 PFAM
Pfam:ATP-grasp_4 156 337 3.7e-20 PFAM
Pfam:RimK 158 358 1e-6 PFAM
Pfam:CPSase_L_D2 159 367 2.8e-79 PFAM
Pfam:ATP-grasp_3 160 339 8.1e-9 PFAM
Pfam:Dala_Dala_lig_C 165 335 1.2e-16 PFAM
Pfam:ATP-grasp 166 337 3.7e-13 PFAM
Biotin_carb_C 379 486 7.14e-48 SMART
Pfam:Biotin_lipoyl 644 710 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199006
Predicted Effect probably benign
Transcript: ENSMUST00000199113
SMART Domains Protein: ENSMUSP00000143266
Gene: ENSMUSG00000027709

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 3.5e-48 PFAM
Pfam:ATP-grasp_4 156 253 4.1e-10 PFAM
Pfam:CPSase_L_D2 159 253 1.2e-24 PFAM
Pfam:Dala_Dala_lig_C 165 254 1.6e-8 PFAM
Pfam:ATP-grasp 166 253 8.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200163
AA Change: T194A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143039
Gene: ENSMUSG00000027709
AA Change: T194A

DomainStartEndE-ValueType
Pfam:Dala_Dala_lig_C 1 115 3.8e-8 PFAM
Pfam:ATP-grasp_4 1 117 1.5e-9 PFAM
Pfam:CPSase_L_D2 1 147 3.9e-59 PFAM
Pfam:Biotin_carb_C 159 200 1.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca1 A T 4: 53,034,031 L2233Q possibly damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Bpifb9a T C 2: 154,260,178 V65A probably benign Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Dtx1 T A 5: 120,695,017 T119S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
H2afx T C 9: 44,334,912 Y51H probably damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr1411 T C 1: 92,596,563 S15P probably benign Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Ruvbl1 T A 6: 88,479,226 I154N possibly damaging Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Spam1 T A 6: 24,796,356 I102K possibly damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Zic5 A G 14: 122,459,421 L594P unknown Het
Other mutations in Mccc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Mccc1 APN 3 35989860 missense probably damaging 0.99
IGL01601:Mccc1 APN 3 35989952 missense probably benign 0.00
IGL01671:Mccc1 APN 3 35964460 missense probably benign
IGL01784:Mccc1 APN 3 35976748 missense probably damaging 0.99
IGL01878:Mccc1 APN 3 35975892 missense probably damaging 1.00
IGL02088:Mccc1 APN 3 35974202 missense probably damaging 1.00
IGL02709:Mccc1 APN 3 35990739 makesense probably null
IGL02932:Mccc1 APN 3 35960029 missense possibly damaging 0.86
IGL02972:Mccc1 APN 3 35985089 missense possibly damaging 0.58
IGL03145:Mccc1 APN 3 35968446 missense probably benign
P0019:Mccc1 UTSW 3 35964395 missense probably benign 0.00
R0244:Mccc1 UTSW 3 35990047 critical splice donor site probably null
R0391:Mccc1 UTSW 3 35963570 splice site probably benign
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1591:Mccc1 UTSW 3 35989857 missense probably damaging 1.00
R1663:Mccc1 UTSW 3 35978933 missense probably damaging 1.00
R1827:Mccc1 UTSW 3 35985001 missense probably damaging 1.00
R3800:Mccc1 UTSW 3 36000509 missense probably damaging 1.00
R4290:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4291:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4707:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4757:Mccc1 UTSW 3 35995917 missense probably benign 0.32
R4783:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4785:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4798:Mccc1 UTSW 3 35985001 missense probably damaging 0.99
R4807:Mccc1 UTSW 3 35985046 missense probably damaging 1.00
R4915:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R4917:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R5010:Mccc1 UTSW 3 35979017 missense probably benign 0.15
R5106:Mccc1 UTSW 3 35972564 missense probably benign 0.22
R5168:Mccc1 UTSW 3 35990780 nonsense probably null
R5241:Mccc1 UTSW 3 35974196 missense probably benign 0.03
R5444:Mccc1 UTSW 3 35976742 missense probably benign 0.00
R5677:Mccc1 UTSW 3 35990048 critical splice donor site probably null
R5838:Mccc1 UTSW 3 35985082 missense possibly damaging 0.88
R5881:Mccc1 UTSW 3 35964382 missense probably benign 0.00
R6248:Mccc1 UTSW 3 35990164 missense probably damaging 1.00
R6381:Mccc1 UTSW 3 35976727 missense probably benign 0.13
R6612:Mccc1 UTSW 3 35993930 missense probably benign 0.01
R6769:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R6771:Mccc1 UTSW 3 35989843 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGAATCCGGGTATGGTG -3'
(R):5'- TTGTCACCAGATTGCAGCAG -3'

Sequencing Primer
(F):5'- CAAGACAGGGTTTCTCTGTATAGCC -3'
(R):5'- CAGGAGAGAAGATTCCTTTGAGCC -3'
Posted On2018-06-06