Incidental Mutation 'R6531:Rfc1'
ID522339
Institutional Source Beutler Lab
Gene Symbol Rfc1
Ensembl Gene ENSMUSG00000029191
Gene Namereplication factor C (activator 1) 1
Synonyms140kDa, Recc1, Alp145, RFC140
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6531 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location65261850-65335670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65312979 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 62 (K62E)
Ref Sequence ENSEMBL: ENSMUSP00000134444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172732] [ENSMUST00000203471] [ENSMUST00000203581] [ENSMUST00000204965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172732
AA Change: K62E

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134444
Gene: ENSMUSG00000029191
AA Change: K62E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 5.2e-62 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197871
Predicted Effect possibly damaging
Transcript: ENSMUST00000203471
AA Change: K62E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144954
Gene: ENSMUSG00000029191
AA Change: K62E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203581
AA Change: K62E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145385
Gene: ENSMUSG00000029191
AA Change: K62E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
BRCT 415 493 7.39e-17 SMART
low complexity region 498 516 N/A INTRINSIC
AAA 640 775 9.65e-10 SMART
Pfam:RFC1 912 1065 2.6e-61 PFAM
low complexity region 1117 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203644
Predicted Effect possibly damaging
Transcript: ENSMUST00000204965
AA Change: K62E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144980
Gene: ENSMUSG00000029191
AA Change: K62E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1131 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Rfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Rfc1 APN 5 65296009 missense probably benign 0.00
IGL00909:Rfc1 APN 5 65279699 missense probably benign 0.00
IGL01791:Rfc1 APN 5 65263145 missense probably benign 0.00
IGL01884:Rfc1 APN 5 65274460 missense possibly damaging 0.94
IGL02737:Rfc1 APN 5 65311163 missense possibly damaging 0.82
Disturbing UTSW 5 65266162 missense probably damaging 1.00
P0038:Rfc1 UTSW 5 65287961 missense probably damaging 1.00
R0317:Rfc1 UTSW 5 65296052 splice site probably null
R0452:Rfc1 UTSW 5 65264297 missense probably benign 0.01
R0699:Rfc1 UTSW 5 65319399 splice site probably null
R0945:Rfc1 UTSW 5 65278709 critical splice donor site probably null
R1192:Rfc1 UTSW 5 65293911 missense probably benign 0.03
R1341:Rfc1 UTSW 5 65291194 missense probably damaging 1.00
R1425:Rfc1 UTSW 5 65319518 missense probably damaging 1.00
R1551:Rfc1 UTSW 5 65277363 missense probably damaging 0.99
R1800:Rfc1 UTSW 5 65264379 missense probably damaging 1.00
R1969:Rfc1 UTSW 5 65319524 missense probably damaging 1.00
R2006:Rfc1 UTSW 5 65311054 nonsense probably null
R2026:Rfc1 UTSW 5 65288029 missense probably damaging 1.00
R2073:Rfc1 UTSW 5 65301939 missense probably damaging 0.98
R2137:Rfc1 UTSW 5 65311039 critical splice donor site probably null
R2330:Rfc1 UTSW 5 65312969 missense possibly damaging 0.94
R3774:Rfc1 UTSW 5 65264406 missense probably damaging 1.00
R3787:Rfc1 UTSW 5 65296014 missense probably benign 0.00
R4920:Rfc1 UTSW 5 65287928 missense probably damaging 1.00
R5055:Rfc1 UTSW 5 65266162 missense probably damaging 1.00
R5308:Rfc1 UTSW 5 65279461 missense probably damaging 0.99
R5723:Rfc1 UTSW 5 65277426 missense probably null 0.78
R5729:Rfc1 UTSW 5 65277452 missense probably damaging 1.00
R5844:Rfc1 UTSW 5 65293787 missense probably benign 0.19
R6045:Rfc1 UTSW 5 65279549 missense probably damaging 1.00
R6484:Rfc1 UTSW 5 65293677 missense probably benign 0.01
R6495:Rfc1 UTSW 5 65273815 intron probably null
R6717:Rfc1 UTSW 5 65302004 nonsense probably null
R6717:Rfc1 UTSW 5 65312961 missense probably damaging 0.97
R6845:Rfc1 UTSW 5 65311116 missense possibly damaging 0.53
R6880:Rfc1 UTSW 5 65277386 missense probably benign 0.14
R7329:Rfc1 UTSW 5 65263135 missense unknown
R7331:Rfc1 UTSW 5 65311044 missense probably damaging 1.00
R7466:Rfc1 UTSW 5 65275426 missense probably damaging 1.00
R7497:Rfc1 UTSW 5 65279498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCGCTGACAACTGTTCC -3'
(R):5'- TGCGTGATGTTAGTAGTACCC -3'

Sequencing Primer
(F):5'- GCTGACAACTGTTCCAAGGAC -3'
(R):5'- AGTAGTACCCTTATGTACTCTAGGTG -3'
Posted On2018-06-06