Incidental Mutation 'R6562:Pik3r3'
ID522431
Institutional Source Beutler Lab
Gene Symbol Pik3r3
Ensembl Gene ENSMUSG00000028698
Gene Namephosphoinositide-3-kinase regulatory subunit 3
Synonymsp55pik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116221618-116303056 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 116299809 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 496 (Q496*)
Ref Sequence ENSEMBL: ENSMUSP00000150163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030464] [ENSMUST00000106490] [ENSMUST00000216692]
Predicted Effect probably null
Transcript: ENSMUST00000030464
AA Change: Q455*
SMART Domains Protein: ENSMUSP00000030464
Gene: ENSMUSG00000028698
AA Change: Q455*

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
SH2 63 146 2.36e-29 SMART
Pfam:PI3K_P85_iSH2 163 331 2.7e-66 PFAM
SH2 356 438 4.34e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106490
AA Change: Q396*
SMART Domains Protein: ENSMUSP00000102099
Gene: ENSMUSG00000028698
AA Change: Q396*

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
SH2 63 146 2.36e-29 SMART
SH2 297 379 4.34e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000216692
AA Change: Q496*
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) phosphorylates phosphatidylinositol and similar compounds, which then serve as second messengers in growth signaling pathways. PI3K is composed of a catalytic and a regulatory subunit. The protein encoded by this gene represents a regulatory subunit of PI3K. The encoded protein contains two SH2 domains through which it binds activated protein tyrosine kinases to regulate their activity. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Pik3r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03029:Pik3r3 APN 4 116299801 missense probably damaging 1.00
PIT4305001:Pik3r3 UTSW 4 116292126 missense probably benign 0.02
R0126:Pik3r3 UTSW 4 116256268 missense probably damaging 0.98
R1667:Pik3r3 UTSW 4 116222317 missense probably damaging 0.99
R2850:Pik3r3 UTSW 4 116270784 splice site probably benign
R4974:Pik3r3 UTSW 4 116286191 missense probably benign 0.01
R5871:Pik3r3 UTSW 4 116286158 nonsense probably null
R5908:Pik3r3 UTSW 4 116272758 missense probably benign 0.02
R7378:Pik3r3 UTSW 4 116270830 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAAGTGAAGCACTGTGTC -3'
(R):5'- AGCTTAGTCCATCAGTGCAGC -3'

Sequencing Primer
(F):5'- GTGAAGCACTGTGTCATCTACAGC -3'
(R):5'- GGGCCCCTCATTTCTAAATCCAAG -3'
Posted On2018-06-06