Incidental Mutation 'R6562:Slc9a3'
ID522493
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms9030624O13Rik, NHE-3, NHE3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74121457-74169442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74155161 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 191 (V191E)
Ref Sequence ENSEMBL: ENSMUSP00000153255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036208
AA Change: V191E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: V191E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221703
AA Change: V191E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000225423
AA Change: V191E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 unclassified probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATCCTCTTTGTCACTGGG -3'
(R):5'- TTGGTAACGAGCACTTGGC -3'

Sequencing Primer
(F):5'- AGCCCTGGGAAGAGTTGTTCC -3'
(R):5'- TTGGCAAGGTATCCTAAAACCTC -3'
Posted On2018-06-06