Incidental Mutation 'R6488:Ptpro'
ID522505
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6488 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 137393675 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 591 (Y591*)
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167679]
Predicted Effect probably null
Transcript: ENSMUST00000077115
AA Change: Y591*
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: Y591*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167679
AA Change: Y591*
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: Y591*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Meta Mutation Damage Score 0.664 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,625,874 Q334* probably null Het
4933406M09Rik T A 1: 134,390,888 V466D probably damaging Het
Abhd15 T C 11: 77,516,022 F275S possibly damaging Het
Adamts7 A G 9: 90,171,482 T27A probably benign Het
Ankar A G 1: 72,681,808 probably null Het
Ap2a2 T C 7: 141,602,307 V183A probably benign Het
Arhgef37 G A 18: 61,518,052 A134V probably benign Het
Col3a1 C A 1: 45,331,534 probably benign Het
Cxcr5 A G 9: 44,513,979 V127A probably damaging Het
Eif4b T A 15: 102,092,987 probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fam83h T C 15: 76,002,053 E1145G possibly damaging Het
Fcgbp A G 7: 28,093,538 D989G probably damaging Het
Fchsd1 T C 18: 37,967,268 probably null Het
Fcnb T C 2: 28,078,289 K219E probably damaging Het
Fndc7 T C 3: 108,870,575 E355G probably damaging Het
Glis3 T C 19: 28,298,853 H746R probably benign Het
Glod4 A G 11: 76,237,785 V74A probably damaging Het
Gm10436 T C 12: 88,177,587 H152R possibly damaging Het
Gpc6 T C 14: 117,964,713 I445T possibly damaging Het
Hdlbp T C 1: 93,428,224 D337G probably damaging Het
Hnf1a T C 5: 114,955,961 T190A probably benign Het
Iqgap1 G C 7: 80,730,326 T1129R probably benign Het
Kcnc3 T C 7: 44,595,182 F299L possibly damaging Het
Kif1bp C A 10: 62,559,658 probably null Het
Kif26b T C 1: 178,529,573 V4A unknown Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Krtap4-1 G T 11: 99,628,077 R36S unknown Het
Lman1l A G 9: 57,620,643 S10P possibly damaging Het
Lrpprc T C 17: 84,751,353 N693S probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mga T A 2: 119,960,907 N2424K probably damaging Het
Mpdz G T 4: 81,287,733 A1784E probably benign Het
Mpv17l G A 16: 13,946,588 probably null Het
Mtus1 G A 8: 41,041,508 S29L possibly damaging Het
Myo15 A T 11: 60,478,487 H691L possibly damaging Het
Nbea T C 3: 55,717,843 T2276A probably damaging Het
Npas4 A G 19: 4,985,983 S718P probably damaging Het
Ntrk2 T A 13: 58,861,356 N320K possibly damaging Het
Nup214 T A 2: 31,991,372 I414N possibly damaging Het
Oas2 A G 5: 120,738,363 F15S probably damaging Het
Olfr1474 T C 19: 13,471,617 Y216H probably damaging Het
Olfr625-ps1 T C 7: 103,683,078 I110T probably damaging Het
Pabpc6 A G 17: 9,669,599 Y8H probably damaging Het
Pbx1 T A 1: 168,191,395 N294Y probably damaging Het
Pcyt1a T C 16: 32,467,081 M190T probably damaging Het
Pogk T C 1: 166,399,422 I387V possibly damaging Het
Ppp6r2 T C 15: 89,268,538 L294P probably benign Het
Ptprn2 T A 12: 116,872,038 I331K probably benign Het
Ptprz1 T A 6: 23,001,517 L1202* probably null Het
Rab37 A G 11: 115,157,963 T73A probably benign Het
Rad51ap2 T G 12: 11,458,160 S694R possibly damaging Het
Rb1cc1 T A 1: 6,270,727 D148E probably damaging Het
Rraga G A 4: 86,576,328 R137H probably damaging Het
Serpinf2 A G 11: 75,437,503 V73A probably benign Het
Siglec1 T C 2: 131,081,307 N506S probably damaging Het
Slc35e4 T C 11: 3,912,602 T196A possibly damaging Het
St6galnac3 C T 3: 153,411,757 A110T probably damaging Het
Thsd1 T C 8: 22,243,717 V260A probably benign Het
Tpbg T A 9: 85,844,485 V169D possibly damaging Het
Trav16n A G 14: 53,351,585 E106G probably benign Het
Vmn1r219 T C 13: 23,162,965 I108T probably benign Het
Vmn2r50 T C 7: 10,037,717 I686V probably damaging Het
Zdhhc20 C T 14: 57,840,832 R329K probably benign Het
Zfp64 A G 2: 168,935,209 probably null Het
Zfp941 C T 7: 140,812,750 R232H probably benign Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTTGAAGTCACAGTACAAAC -3'
(R):5'- TCCTTGAGAACATCTGTCTGC -3'

Sequencing Primer
(F):5'- ACACTAATGCCCCTTCCGG -3'
(R):5'- GAGAACATCTGTCTGCCTATGC -3'
Posted On2018-06-06