Incidental Mutation 'R6563:Tnn'
ID522515
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R6563 (G1)
Quality Score189.009
Status Validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 160088398 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1250 (S1250C)
Ref Sequence ENSEMBL: ENSMUSP00000115685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: S1514C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: S1514C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: S1250C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: S1250C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Sh3bgr A G 16: 96,205,943 probably null Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 synonymous probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCCATTGTCTGGTGAC -3'
(R):5'- TCCTAGATATTTCCTGTTGGGAC -3'

Sequencing Primer
(F):5'- TGGTGACACCATGAAGACCG -3'
(R):5'- CATAGTTCTTATCTCTCTTGCAGGGG -3'
Posted On2018-06-06