Incidental Mutation 'R6488:Lrpprc'
ID 522582
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Name leucine-rich PPR-motif containing
Synonyms Lrp130, 3110001K13Rik
MMRRC Submission 044620-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6488 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 85012675-85098214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85058781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 693 (N693S)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
AlphaFold Q6PB66
Predicted Effect probably damaging
Transcript: ENSMUST00000112308
AA Change: N693S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: N693S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160414
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,275,298 (GRCm39) Q334* probably null Het
Abhd15 T C 11: 77,406,848 (GRCm39) F275S possibly damaging Het
Adamts7 A G 9: 90,053,535 (GRCm39) T27A probably benign Het
Ankar A G 1: 72,720,967 (GRCm39) probably null Het
Ap2a2 T C 7: 141,182,220 (GRCm39) V183A probably benign Het
Arhgef37 G A 18: 61,651,123 (GRCm39) A134V probably benign Het
Col3a1 C A 1: 45,370,694 (GRCm39) probably benign Het
Cplx3 A G 9: 57,527,926 (GRCm39) S10P possibly damaging Het
Cxcr5 A G 9: 44,425,276 (GRCm39) V127A probably damaging Het
Eif4b T A 15: 102,001,422 (GRCm39) probably benign Het
Ext2 A G 2: 93,636,430 (GRCm39) V228A probably damaging Het
Fam83h T C 15: 75,873,902 (GRCm39) E1145G possibly damaging Het
Fcgbp A G 7: 27,792,963 (GRCm39) D989G probably damaging Het
Fchsd1 T C 18: 38,100,321 (GRCm39) probably null Het
Fcnb T C 2: 27,968,301 (GRCm39) K219E probably damaging Het
Fndc7 T C 3: 108,777,891 (GRCm39) E355G probably damaging Het
Glis3 T C 19: 28,276,253 (GRCm39) H746R probably benign Het
Glod4 A G 11: 76,128,611 (GRCm39) V74A probably damaging Het
Gpc6 T C 14: 118,202,125 (GRCm39) I445T possibly damaging Het
Hdlbp T C 1: 93,355,946 (GRCm39) D337G probably damaging Het
Hnf1a T C 5: 115,094,020 (GRCm39) T190A probably benign Het
Iqgap1 G C 7: 80,380,074 (GRCm39) T1129R probably benign Het
Kcnc3 T C 7: 44,244,606 (GRCm39) F299L possibly damaging Het
Kif26b T C 1: 178,357,138 (GRCm39) V4A unknown Het
Kifbp C A 10: 62,395,437 (GRCm39) probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Krtap4-1 G T 11: 99,518,903 (GRCm39) R36S unknown Het
Lrrc49 A T 9: 60,509,916 (GRCm39) F157L probably damaging Het
Mettl22 T C 16: 8,305,225 (GRCm39) F293L probably damaging Het
Mga T A 2: 119,791,388 (GRCm39) N2424K probably damaging Het
Mgat4f T A 1: 134,318,626 (GRCm39) V466D probably damaging Het
Mpdz G T 4: 81,205,970 (GRCm39) A1784E probably benign Het
Mpv17l G A 16: 13,764,452 (GRCm39) probably null Het
Mtus1 G A 8: 41,494,545 (GRCm39) S29L possibly damaging Het
Myo15a A T 11: 60,369,313 (GRCm39) H691L possibly damaging Het
Nbea T C 3: 55,625,264 (GRCm39) T2276A probably damaging Het
Npas4 A G 19: 5,036,011 (GRCm39) S718P probably damaging Het
Ntrk2 T A 13: 59,009,170 (GRCm39) N320K possibly damaging Het
Nup214 T A 2: 31,881,384 (GRCm39) I414N possibly damaging Het
Oas2 A G 5: 120,876,428 (GRCm39) F15S probably damaging Het
Or52z15 T C 7: 103,332,285 (GRCm39) I110T probably damaging Het
Or5b118 T C 19: 13,448,981 (GRCm39) Y216H probably damaging Het
Pabpc6 A G 17: 9,888,528 (GRCm39) Y8H probably damaging Het
Pbx1 T A 1: 168,018,964 (GRCm39) N294Y probably damaging Het
Pcyt1a T C 16: 32,285,899 (GRCm39) M190T probably damaging Het
Pogk T C 1: 166,226,991 (GRCm39) I387V possibly damaging Het
Ppp6r2 T C 15: 89,152,741 (GRCm39) L294P probably benign Het
Pramel51 T C 12: 88,144,357 (GRCm39) H152R possibly damaging Het
Ptprn2 T A 12: 116,835,658 (GRCm39) I331K probably benign Het
Ptpro T G 6: 137,370,673 (GRCm39) Y591* probably null Het
Ptprz1 T A 6: 23,001,516 (GRCm39) L1202* probably null Het
Rab37 A G 11: 115,048,789 (GRCm39) T73A probably benign Het
Rad51ap2 T G 12: 11,508,161 (GRCm39) S694R possibly damaging Het
Rb1cc1 T A 1: 6,340,951 (GRCm39) D148E probably damaging Het
Rraga G A 4: 86,494,565 (GRCm39) R137H probably damaging Het
Serpinf2 A G 11: 75,328,329 (GRCm39) V73A probably benign Het
Siglec1 T C 2: 130,923,227 (GRCm39) N506S probably damaging Het
Slc35e4 T C 11: 3,862,602 (GRCm39) T196A possibly damaging Het
St6galnac3 C T 3: 153,117,394 (GRCm39) A110T probably damaging Het
Thsd1 T C 8: 22,733,733 (GRCm39) V260A probably benign Het
Tpbg T A 9: 85,726,538 (GRCm39) V169D possibly damaging Het
Trav16n A G 14: 53,589,042 (GRCm39) E106G probably benign Het
Vmn1r219 T C 13: 23,347,135 (GRCm39) I108T probably benign Het
Vmn2r50 T C 7: 9,771,644 (GRCm39) I686V probably damaging Het
Zdhhc20 C T 14: 58,078,289 (GRCm39) R329K probably benign Het
Zfp64 A G 2: 168,777,129 (GRCm39) probably null Het
Zfp941 C T 7: 140,392,663 (GRCm39) R232H probably benign Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 85,057,953 (GRCm39) missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 85,012,840 (GRCm39) utr 3 prime probably benign
IGL01380:Lrpprc APN 17 85,030,158 (GRCm39) missense probably benign
IGL01560:Lrpprc APN 17 85,015,547 (GRCm39) missense probably benign 0.07
IGL01582:Lrpprc APN 17 85,061,971 (GRCm39) missense probably null 0.00
IGL01996:Lrpprc APN 17 85,080,698 (GRCm39) missense probably benign
IGL02109:Lrpprc APN 17 85,033,998 (GRCm39) nonsense probably null
IGL02163:Lrpprc APN 17 85,060,900 (GRCm39) missense probably damaging 0.97
IGL02248:Lrpprc APN 17 85,078,895 (GRCm39) missense probably damaging 0.99
IGL02503:Lrpprc APN 17 85,033,767 (GRCm39) missense probably benign
IGL02545:Lrpprc APN 17 85,082,853 (GRCm39) missense probably benign
IGL02570:Lrpprc APN 17 85,057,981 (GRCm39) missense probably damaging 1.00
IGL02636:Lrpprc APN 17 85,060,532 (GRCm39) unclassified probably benign
IGL02943:Lrpprc APN 17 85,078,878 (GRCm39) missense probably benign 0.00
IGL03008:Lrpprc APN 17 85,058,675 (GRCm39) missense probably benign 0.05
elusory UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
phantom UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R6807_Lrpprc_629 UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
Stereotype UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
thus UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
P0023:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0302:Lrpprc UTSW 17 85,047,506 (GRCm39) missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 85,060,540 (GRCm39) critical splice donor site probably null
R0448:Lrpprc UTSW 17 85,078,322 (GRCm39) missense probably benign 0.09
R1396:Lrpprc UTSW 17 85,033,731 (GRCm39) missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 85,047,509 (GRCm39) missense probably damaging 1.00
R2019:Lrpprc UTSW 17 85,059,759 (GRCm39) missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 85,077,505 (GRCm39) missense probably benign 0.00
R2312:Lrpprc UTSW 17 85,080,686 (GRCm39) missense probably damaging 0.96
R2319:Lrpprc UTSW 17 85,033,818 (GRCm39) missense probably benign
R2568:Lrpprc UTSW 17 85,034,077 (GRCm39) missense probably damaging 1.00
R3013:Lrpprc UTSW 17 85,074,497 (GRCm39) missense probably benign 0.04
R3620:Lrpprc UTSW 17 85,077,452 (GRCm39) missense probably benign 0.01
R3789:Lrpprc UTSW 17 85,078,956 (GRCm39) missense probably benign 0.25
R3848:Lrpprc UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
R3973:Lrpprc UTSW 17 85,078,269 (GRCm39) critical splice donor site probably null
R4111:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R4164:Lrpprc UTSW 17 85,038,617 (GRCm39) missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 85,047,970 (GRCm39) critical splice donor site probably null
R4531:Lrpprc UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
R4832:Lrpprc UTSW 17 85,014,584 (GRCm39) missense probably benign 0.24
R4947:Lrpprc UTSW 17 85,078,966 (GRCm39) missense probably benign 0.02
R5134:Lrpprc UTSW 17 85,058,684 (GRCm39) missense probably benign 0.00
R5333:Lrpprc UTSW 17 85,097,821 (GRCm39) missense probably benign 0.01
R5950:Lrpprc UTSW 17 85,047,598 (GRCm39) missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 85,020,250 (GRCm39) missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 85,074,452 (GRCm39) missense probably benign
R6253:Lrpprc UTSW 17 85,048,065 (GRCm39) missense probably benign 0.00
R6807:Lrpprc UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 85,063,711 (GRCm39) missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 85,030,131 (GRCm39) missense probably benign 0.42
R6955:Lrpprc UTSW 17 85,084,417 (GRCm39) missense probably damaging 0.98
R7448:Lrpprc UTSW 17 85,079,567 (GRCm39) missense probably damaging 0.99
R7727:Lrpprc UTSW 17 85,084,375 (GRCm39) missense probably benign 0.00
R8003:Lrpprc UTSW 17 85,059,745 (GRCm39) missense probably benign 0.01
R8178:Lrpprc UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R8310:Lrpprc UTSW 17 85,080,524 (GRCm39) missense probably damaging 1.00
R8322:Lrpprc UTSW 17 85,047,496 (GRCm39) critical splice donor site probably null
R8389:Lrpprc UTSW 17 85,080,742 (GRCm39) missense possibly damaging 0.79
R8560:Lrpprc UTSW 17 85,047,495 (GRCm39) splice site probably benign
R8777:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8777-TAIL:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8868:Lrpprc UTSW 17 85,078,920 (GRCm39) missense probably damaging 0.99
R8970:Lrpprc UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
R9042:Lrpprc UTSW 17 85,059,736 (GRCm39) critical splice donor site probably null
R9493:Lrpprc UTSW 17 85,015,548 (GRCm39) missense probably damaging 0.99
R9664:Lrpprc UTSW 17 85,020,262 (GRCm39) missense probably damaging 0.99
X0026:Lrpprc UTSW 17 85,018,090 (GRCm39) missense probably benign 0.42
Z1088:Lrpprc UTSW 17 85,077,928 (GRCm39) critical splice acceptor site probably null
Z1088:Lrpprc UTSW 17 85,039,212 (GRCm39) nonsense probably null
Z1176:Lrpprc UTSW 17 85,077,859 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTAACCAAGGAGCCCTTCC -3'
(R):5'- AAAACTGGCTTGCACATGC -3'

Sequencing Primer
(F):5'- ATCCATTCAGTGCATCAGGG -3'
(R):5'- TCAAAATACTGTCAACT -3'
Posted On 2018-06-06