Incidental Mutation 'R6565:Kit'
ID522609
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R6565 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75645853 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 673 (T673A)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
PDB Structure
Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005815
AA Change: T673A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: T673A

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136002
Predicted Effect probably damaging
Transcript: ENSMUST00000144270
AA Change: T669A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: T669A

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202167
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg C A 15: 60,920,810 C96F probably damaging Het
Abca7 C T 10: 80,011,788 P1764L probably damaging Het
Acvr1 G A 2: 58,479,757 T80M probably damaging Het
Adgrb2 T C 4: 130,019,276 L1398P probably damaging Het
B4galnt3 G A 6: 120,217,479 Q362* probably null Het
Cadm3 G T 1: 173,341,709 Q246K possibly damaging Het
Cdc14b T C 13: 64,225,630 T110A probably benign Het
Cyp2c55 A C 19: 39,042,122 D466A probably benign Het
Dmrtb1 T C 4: 107,679,345 Y308C probably damaging Het
Fat3 T C 9: 15,915,327 D4443G probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Grin2d A G 7: 45,834,755 L772P probably damaging Het
Gsdme T C 6: 50,229,449 N138S probably damaging Het
Hmgb4 T A 4: 128,260,595 Y60F probably benign Het
Ift172 G A 5: 31,275,883 A554V possibly damaging Het
Iigp1 T A 18: 60,390,767 V319E probably damaging Het
Lilra6 A T 7: 3,915,020 W42R probably benign Het
Mia3 A T 1: 183,331,485 H477Q probably damaging Het
Oas1b C A 5: 120,814,546 Q101K possibly damaging Het
Olfr56 A G 11: 49,134,812 M207V probably damaging Het
Olfr586 T C 7: 103,122,238 H178R probably damaging Het
Plcl1 T A 1: 55,697,958 C819* probably null Het
Pmfbp1 C T 8: 109,525,428 Q402* probably null Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Skor2 C G 18: 76,859,912 A443G possibly damaging Het
Tapbpl A G 6: 125,228,344 V213A probably benign Het
Trim52 G A 14: 106,107,219 D104N probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTACTTCACTCAGCACAATG -3'
(R):5'- TATGACCCCATGAACTGCCTG -3'

Sequencing Primer
(F):5'- TTGATGAGCGGTGTTAACAGATAG -3'
(R):5'- TGAACTGCCTGTCAACAGCTG -3'
Posted On2018-06-06