Incidental Mutation 'R6567:Tesk2'
ID522730
Institutional Source Beutler Lab
Gene Symbol Tesk2
Ensembl Gene ENSMUSG00000033985
Gene Nametestis-specific kinase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6567 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116720948-116805956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116792164 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 157 (A157V)
Ref Sequence ENSEMBL: ENSMUSP00000102067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045542] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459]
Predicted Effect probably damaging
Transcript: ENSMUST00000045542
AA Change: A157V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985
AA Change: A157V

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106455
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106456
AA Change: A157V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985
AA Change: A157V

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106459
AA Change: A157V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985
AA Change: A157V

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142529
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,839,115 Y87F probably benign Het
9930111J21Rik1 T C 11: 48,948,123 T546A probably benign Het
Ahnak G T 19: 9,008,806 V2485L probably benign Het
C2cd5 T C 6: 143,031,248 I722M possibly damaging Het
Clca4b A G 3: 144,932,339 I54T possibly damaging Het
Dennd2c C T 3: 103,132,019 A161V probably benign Het
Dmxl1 T C 18: 49,859,179 Y331H probably damaging Het
Dnajc2 G A 5: 21,766,678 R247W probably damaging Het
Dock3 T C 9: 106,896,747 T380A probably benign Het
Evc2 T C 5: 37,419,164 V1044A probably benign Het
Ints2 T C 11: 86,226,661 H745R probably benign Het
Kcnh1 T A 1: 192,277,104 M322K probably benign Het
Lrrc6 C T 15: 66,438,379 V347I probably benign Het
Mmp19 A G 10: 128,796,406 T191A probably benign Het
Mms19 A G 19: 41,949,767 probably null Het
Ncapd3 T C 9: 27,067,004 I833T possibly damaging Het
Nif3l1 T A 1: 58,455,630 C253S probably benign Het
Olfr589 A T 7: 103,154,928 I273K possibly damaging Het
Pcsk1 T A 13: 75,130,070 I584N probably damaging Het
Pms2 T C 5: 143,928,968 V50A probably damaging Het
Rptor A G 11: 119,896,012 I1268V probably benign Het
Scap C T 9: 110,383,562 R1021W probably damaging Het
Soga3 G T 10: 29,147,283 V209F probably benign Het
Sos1 A T 17: 80,433,503 Y618N probably damaging Het
Tm6sf2 C A 8: 70,075,524 H108N probably damaging Het
Trank1 T C 9: 111,347,521 V287A probably benign Het
Tsks A T 7: 44,953,881 Q369L probably damaging Het
Vmn2r58 T C 7: 41,865,249 T99A probably benign Het
Wbp11 C T 6: 136,820,539 S294N probably benign Het
Zfp608 T C 18: 54,897,556 Y1104C probably damaging Het
Zfp759 T A 13: 67,139,086 S234T probably benign Het
Other mutations in Tesk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Tesk2 APN 4 116771801 missense possibly damaging 0.68
IGL02051:Tesk2 APN 4 116751184 missense probably damaging 1.00
IGL02223:Tesk2 APN 4 116741825 nonsense probably null
IGL02747:Tesk2 APN 4 116802879 missense probably benign 0.31
IGL02942:Tesk2 APN 4 116771820 missense probably damaging 0.99
R1804:Tesk2 UTSW 4 116800621 unclassified probably benign
R1936:Tesk2 UTSW 4 116741824 missense probably benign 0.23
R1986:Tesk2 UTSW 4 116751193 missense probably damaging 1.00
R2414:Tesk2 UTSW 4 116801757 missense possibly damaging 0.96
R4632:Tesk2 UTSW 4 116741712 missense probably benign 0.01
R4896:Tesk2 UTSW 4 116802993 missense probably benign
R5186:Tesk2 UTSW 4 116741896 missense probably damaging 1.00
R5209:Tesk2 UTSW 4 116724698 start gained probably benign
R5278:Tesk2 UTSW 4 116805936 intron probably benign
R5769:Tesk2 UTSW 4 116802315 intron probably null
R6199:Tesk2 UTSW 4 116792170 missense probably damaging 0.98
R6464:Tesk2 UTSW 4 116802849 missense probably damaging 1.00
R6867:Tesk2 UTSW 4 116801798 missense probably damaging 0.99
R7028:Tesk2 UTSW 4 116802687 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTTTAGACAGGGTCTCAC -3'
(R):5'- CAGAGATTCCCCATAGTTCTAGATTTC -3'

Sequencing Primer
(F):5'- GGGTCTCACTTTTAAGAGCACTGAC -3'
(R):5'- GTGCTCCTCAACAGTTATG -3'
Posted On2018-06-06