Incidental Mutation 'R6490:Nsd3'
ID522763
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R6490 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25714185 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 414 (C414R)
Ref Sequence ENSEMBL: ENSMUSP00000123028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000153597]
Predicted Effect probably damaging
Transcript: ENSMUST00000084026
AA Change: C1376R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: C1376R

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139966
AA Change: C1327R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: C1327R

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142395
AA Change: C1376R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: C1376R

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153597
AA Change: C414R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123028
Gene: ENSMUSG00000054823
AA Change: C414R

DomainStartEndE-ValueType
PWWP 17 79 8.62e-18 SMART
AWS 152 203 2.61e-17 SMART
SET 204 327 2.17e-41 SMART
PostSET 328 344 2.63e-3 SMART
low complexity region 358 375 N/A INTRINSIC
PHD 381 424 4.32e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T G 8: 121,540,554 K38T probably benign Het
4932415D10Rik A T 10: 82,289,304 L2624Q possibly damaging Het
Abca13 A G 11: 9,298,661 T2803A probably benign Het
Adam23 A G 1: 63,557,454 D565G probably damaging Het
Adcy3 A G 12: 4,212,150 T1067A probably damaging Het
Agrn A T 4: 156,167,362 Y1921* probably null Het
Apc2 A G 10: 80,313,923 N1604D probably benign Het
Atxn7 A T 14: 14,089,446 R321* probably null Het
Axin1 T A 17: 26,142,994 I104N probably damaging Het
Bahd1 T C 2: 118,917,138 S413P probably benign Het
Baz2b C T 2: 59,901,729 C2024Y probably damaging Het
Cacna1i T A 15: 80,378,247 V1388E probably damaging Het
Ccdc129 A G 6: 55,976,420 D907G probably damaging Het
Ces4a G A 8: 105,149,458 V544M probably benign Het
Cntn3 G A 6: 102,278,340 T199I probably damaging Het
Col6a4 A T 9: 106,074,992 L569* probably null Het
Ctnna2 A G 6: 77,143,909 I12T probably benign Het
Dhx37 A G 5: 125,419,132 M754T probably benign Het
Dmrt1 T A 19: 25,546,031 S249T possibly damaging Het
Ell G T 8: 70,572,903 S59I probably damaging Het
Fam89a G A 8: 124,741,243 S110F probably damaging Het
Fer1l4 A C 2: 156,047,914 F278V possibly damaging Het
Fyn T C 10: 39,551,402 I427T probably damaging Het
Galnt14 T C 17: 73,525,370 D250G probably damaging Het
Glp1r T C 17: 30,924,572 V194A probably damaging Het
Glt1d1 T A 5: 127,644,296 probably null Het
Gm7995 A G 14: 42,311,370 K69R probably benign Het
Grip1 A G 10: 119,986,424 T379A possibly damaging Het
Gtpbp2 G T 17: 46,168,221 A570S probably benign Het
Hmcn1 T C 1: 150,583,278 I5192V probably benign Het
Igfl3 A T 7: 18,179,919 I65F possibly damaging Het
Igsf10 G T 3: 59,329,571 T1063K probably benign Het
Itfg1 A G 8: 85,740,301 V381A probably benign Het
Jmjd8 T A 17: 25,829,112 V16E probably benign Het
Kank1 A G 19: 25,410,085 Y374C probably damaging Het
Kcnma1 C T 14: 23,336,097 V891I possibly damaging Het
Kif20a C A 18: 34,629,490 T472K possibly damaging Het
Klhl32 A T 4: 24,711,578 probably benign Het
Lrrc37a A G 11: 103,456,660 S3070P unknown Het
Mettl21e T G 1: 44,210,265 Y77S probably damaging Het
Mlst8 G T 17: 24,477,961 D82E probably benign Het
Mrgprx2 A T 7: 48,482,869 L67Q probably damaging Het
Mylk T A 16: 34,929,867 L1192Q possibly damaging Het
Myt1l A T 12: 29,832,366 Y520F unknown Het
Naip2 A T 13: 100,160,685 W948R probably benign Het
Nlrp9a A C 7: 26,550,886 K25N probably damaging Het
Oit3 A T 10: 59,438,552 V142D possibly damaging Het
Olfr171 C T 16: 19,624,444 V219M probably benign Het
P2ry6 T C 7: 100,938,373 T260A probably damaging Het
Papola A G 12: 105,804,937 Q87R probably benign Het
Pla2g4a T A 1: 149,851,335 R557* probably null Het
Rgs13 G T 1: 144,140,838 H56N probably damaging Het
Sbf1 T C 15: 89,304,908 S537G probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Stam2 T C 2: 52,720,942 T23A probably benign Het
Tbl1xr1 C A 3: 22,203,977 H467Q probably damaging Het
Tmem131l A G 3: 83,913,280 S1222P possibly damaging Het
Tmem43 G T 6: 91,478,777 Q123H probably damaging Het
Tmem43 T A 6: 91,486,880 I379N possibly damaging Het
Trim43c A T 9: 88,844,950 I277F possibly damaging Het
Ttn A G 2: 76,872,867 probably benign Het
Vmn1r75 T A 7: 11,881,076 V245D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps53 A T 11: 76,077,055 M414K probably benign Het
Wrn T G 8: 33,319,220 L249F probably benign Het
Zc3h13 TGATGTCCGGGATGTCCGGGATGTCCGGGATGTCCGGGATGT TGATGTCCGGGATGTCCGGGATGTCCGGGATGT 14: 75,323,558 probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp619 G A 7: 39,534,162 G60R probably benign Het
Zfp623 T A 15: 75,948,459 H421Q probably damaging Het
Zfp827 A G 8: 79,189,977 probably benign Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7308:Nsd3 UTSW 8 25640724 missense probably damaging 1.00
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GGATTCTCTAAGCAAAGCAGGTAG -3'
(R):5'- TGCGCCTCTTTACTGAGAGC -3'

Sequencing Primer
(F):5'- GCCTACACTTTGGAGAAAGACCTTG -3'
(R):5'- GGGATTCCCATTTACATCTGATCTTG -3'
Posted On2018-06-06