Incidental Mutation 'R6490:1700018B08Rik'
ID522770
Institutional Source Beutler Lab
Gene Symbol 1700018B08Rik
Ensembl Gene ENSMUSG00000031809
Gene NameRIKEN cDNA 1700018B08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6490 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location121530780-121544320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121540554 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 38 (K38T)
Ref Sequence ENSEMBL: ENSMUSP00000138106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034265] [ENSMUST00000127664] [ENSMUST00000182460] [ENSMUST00000182739] [ENSMUST00000183280]
Predicted Effect silent
Transcript: ENSMUST00000034265
SMART Domains Protein: ENSMUSP00000034265
Gene: ENSMUSG00000031809

DomainStartEndE-ValueType
Pfam:DUF4568 3 213 1.4e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182145
Predicted Effect probably benign
Transcript: ENSMUST00000182460
AA Change: K38T

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138106
Gene: ENSMUSG00000031809
AA Change: K38T

DomainStartEndE-ValueType
Pfam:DUF4568 23 188 7.2e-90 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000182739
AA Change: K20N
Predicted Effect silent
Transcript: ENSMUST00000183280
SMART Domains Protein: ENSMUSP00000138141
Gene: ENSMUSG00000031809

DomainStartEndE-ValueType
Pfam:DUF4568 3 48 2.1e-6 PFAM
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,289,304 L2624Q possibly damaging Het
Abca13 A G 11: 9,298,661 T2803A probably benign Het
Adam23 A G 1: 63,557,454 D565G probably damaging Het
Adcy3 A G 12: 4,212,150 T1067A probably damaging Het
Agrn A T 4: 156,167,362 Y1921* probably null Het
Apc2 A G 10: 80,313,923 N1604D probably benign Het
Atxn7 A T 14: 14,089,446 R321* probably null Het
Axin1 T A 17: 26,142,994 I104N probably damaging Het
Bahd1 T C 2: 118,917,138 S413P probably benign Het
Baz2b C T 2: 59,901,729 C2024Y probably damaging Het
Cacna1i T A 15: 80,378,247 V1388E probably damaging Het
Ccdc129 A G 6: 55,976,420 D907G probably damaging Het
Ces4a G A 8: 105,149,458 V544M probably benign Het
Cntn3 G A 6: 102,278,340 T199I probably damaging Het
Col6a4 A T 9: 106,074,992 L569* probably null Het
Ctnna2 A G 6: 77,143,909 I12T probably benign Het
Dhx37 A G 5: 125,419,132 M754T probably benign Het
Dmrt1 T A 19: 25,546,031 S249T possibly damaging Het
Ell G T 8: 70,572,903 S59I probably damaging Het
Fam89a G A 8: 124,741,243 S110F probably damaging Het
Fer1l4 A C 2: 156,047,914 F278V possibly damaging Het
Fyn T C 10: 39,551,402 I427T probably damaging Het
Galnt14 T C 17: 73,525,370 D250G probably damaging Het
Glp1r T C 17: 30,924,572 V194A probably damaging Het
Glt1d1 T A 5: 127,644,296 probably null Het
Gm7995 A G 14: 42,311,370 K69R probably benign Het
Grip1 A G 10: 119,986,424 T379A possibly damaging Het
Gtpbp2 G T 17: 46,168,221 A570S probably benign Het
Hmcn1 T C 1: 150,583,278 I5192V probably benign Het
Igfl3 A T 7: 18,179,919 I65F possibly damaging Het
Igsf10 G T 3: 59,329,571 T1063K probably benign Het
Itfg1 A G 8: 85,740,301 V381A probably benign Het
Jmjd8 T A 17: 25,829,112 V16E probably benign Het
Kank1 A G 19: 25,410,085 Y374C probably damaging Het
Kcnma1 C T 14: 23,336,097 V891I possibly damaging Het
Kif20a C A 18: 34,629,490 T472K possibly damaging Het
Klhl32 A T 4: 24,711,578 probably benign Het
Lrrc37a A G 11: 103,456,660 S3070P unknown Het
Mettl21e T G 1: 44,210,265 Y77S probably damaging Het
Mlst8 G T 17: 24,477,961 D82E probably benign Het
Mrgprx2 A T 7: 48,482,869 L67Q probably damaging Het
Mylk T A 16: 34,929,867 L1192Q possibly damaging Het
Myt1l A T 12: 29,832,366 Y520F unknown Het
Naip2 A T 13: 100,160,685 W948R probably benign Het
Nlrp9a A C 7: 26,550,886 K25N probably damaging Het
Nsd3 T C 8: 25,714,185 C414R probably damaging Het
Oit3 A T 10: 59,438,552 V142D possibly damaging Het
Olfr171 C T 16: 19,624,444 V219M probably benign Het
P2ry6 T C 7: 100,938,373 T260A probably damaging Het
Papola A G 12: 105,804,937 Q87R probably benign Het
Pla2g4a T A 1: 149,851,335 R557* probably null Het
Rgs13 G T 1: 144,140,838 H56N probably damaging Het
Sbf1 T C 15: 89,304,908 S537G probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Stam2 T C 2: 52,720,942 T23A probably benign Het
Tbl1xr1 C A 3: 22,203,977 H467Q probably damaging Het
Tmem131l A G 3: 83,913,280 S1222P possibly damaging Het
Tmem43 T A 6: 91,486,880 I379N possibly damaging Het
Tmem43 G T 6: 91,478,777 Q123H probably damaging Het
Trim43c A T 9: 88,844,950 I277F possibly damaging Het
Ttn A G 2: 76,872,867 probably benign Het
Vmn1r75 T A 7: 11,881,076 V245D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps53 A T 11: 76,077,055 M414K probably benign Het
Wrn T G 8: 33,319,220 L249F probably benign Het
Zc3h13 TGATGTCCGGGATGTCCGGGATGTCCGGGATGTCCGGGATGT TGATGTCCGGGATGTCCGGGATGTCCGGGATGT 14: 75,323,558 probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp619 G A 7: 39,534,162 G60R probably benign Het
Zfp623 T A 15: 75,948,459 H421Q probably damaging Het
Zfp827 A G 8: 79,189,977 probably benign Het
Other mutations in 1700018B08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02700:1700018B08Rik APN 8 121535422 critical splice donor site probably null
IGL03124:1700018B08Rik APN 8 121541710 splice site probably benign
R1475:1700018B08Rik UTSW 8 121540588 splice site probably benign
R2883:1700018B08Rik UTSW 8 121539905 missense probably damaging 1.00
R3967:1700018B08Rik UTSW 8 121539980 missense possibly damaging 0.52
R6281:1700018B08Rik UTSW 8 121531881 missense probably damaging 1.00
R6920:1700018B08Rik UTSW 8 121535421 critical splice donor site probably null
R6934:1700018B08Rik UTSW 8 121539973 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCTAGTCACTGAAGGAGCTTCC -3'
(R):5'- TAGGAAGATATCACCTGTGCTAGC -3'

Sequencing Primer
(F):5'- TCACTGAAGGAGCTTCCGGATTC -3'
(R):5'- GATATCACCTGTGCTAGCCTGCC -3'
Posted On2018-06-06