Incidental Mutation 'R6567:Rptor'
ID 522776
Institutional Source Beutler Lab
Gene Symbol Rptor
Ensembl Gene ENSMUSG00000025583
Gene Name regulatory associated protein of MTOR, complex 1
Synonyms Rap, raptor, 4932417H02Rik
MMRRC Submission 044691-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6567 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 119493731-119790402 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119786838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1268 (I1268V)
Ref Sequence ENSEMBL: ENSMUSP00000026671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000147781]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026671
AA Change: I1268V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: I1268V

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Pfam:HEAT_2 559 668 7.9e-11 PFAM
Pfam:HEAT 602 630 1.9e-6 PFAM
low complexity region 755 772 N/A INTRINSIC
low complexity region 877 887 N/A INTRINSIC
low complexity region 939 945 N/A INTRINSIC
WD40 1012 1050 2.56e1 SMART
WD40 1052 1097 4.28e0 SMART
WD40 1105 1151 1.83e2 SMART
WD40 1154 1194 1.82e-2 SMART
WD40 1200 1240 5.35e-1 SMART
WD40 1246 1281 7.13e0 SMART
WD40 1283 1329 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136662
SMART Domains Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147781
SMART Domains Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,838,950 (GRCm39) T546A probably benign Het
Ahnak G T 19: 8,986,170 (GRCm39) V2485L probably benign Het
C2cd5 T C 6: 142,976,974 (GRCm39) I722M possibly damaging Het
Clca4b A G 3: 144,638,100 (GRCm39) I54T possibly damaging Het
Dennd2c C T 3: 103,039,335 (GRCm39) A161V probably benign Het
Dmxl1 T C 18: 49,992,246 (GRCm39) Y331H probably damaging Het
Dnaaf11 C T 15: 66,310,228 (GRCm39) V347I probably benign Het
Dnajc2 G A 5: 21,971,676 (GRCm39) R247W probably damaging Het
Dock3 T C 9: 106,773,946 (GRCm39) T380A probably benign Het
Evc2 T C 5: 37,576,508 (GRCm39) V1044A probably benign Het
Ints2 T C 11: 86,117,487 (GRCm39) H745R probably benign Het
Kcnh1 T A 1: 191,959,412 (GRCm39) M322K probably benign Het
Mmp19 A G 10: 128,632,275 (GRCm39) T191A probably benign Het
Mms19 A G 19: 41,938,206 (GRCm39) probably null Het
Mtcl3 G T 10: 29,023,279 (GRCm39) V209F probably benign Het
Ncapd3 T C 9: 26,978,300 (GRCm39) I833T possibly damaging Het
Nif3l1 T A 1: 58,494,789 (GRCm39) C253S probably benign Het
Or52e2 A T 7: 102,804,135 (GRCm39) I273K possibly damaging Het
Pate5 T A 9: 35,750,411 (GRCm39) Y87F probably benign Het
Pcsk1 T A 13: 75,278,189 (GRCm39) I584N probably damaging Het
Pms2 T C 5: 143,865,786 (GRCm39) V50A probably damaging Het
Scap C T 9: 110,212,630 (GRCm39) R1021W probably damaging Het
Sos1 A T 17: 80,740,932 (GRCm39) Y618N probably damaging Het
Tesk2 C T 4: 116,649,361 (GRCm39) A157V probably damaging Het
Tm6sf2 C A 8: 70,528,174 (GRCm39) H108N probably damaging Het
Trank1 T C 9: 111,176,589 (GRCm39) V287A probably benign Het
Tsks A T 7: 44,603,305 (GRCm39) Q369L probably damaging Het
Vmn2r58 T C 7: 41,514,673 (GRCm39) T99A probably benign Het
Wbp11 C T 6: 136,797,537 (GRCm39) S294N probably benign Het
Zfp608 T C 18: 55,030,628 (GRCm39) Y1104C probably damaging Het
Zfp759 T A 13: 67,287,150 (GRCm39) S234T probably benign Het
Other mutations in Rptor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Rptor APN 11 119,690,271 (GRCm39) missense possibly damaging 0.92
IGL01319:Rptor APN 11 119,781,996 (GRCm39) missense probably benign 0.01
IGL01375:Rptor APN 11 119,787,262 (GRCm39) missense possibly damaging 0.68
IGL01899:Rptor APN 11 119,748,279 (GRCm39) missense probably benign 0.04
IGL01927:Rptor APN 11 119,548,500 (GRCm39) missense probably damaging 1.00
IGL02312:Rptor APN 11 119,737,741 (GRCm39) missense possibly damaging 0.84
IGL02620:Rptor APN 11 119,671,413 (GRCm39) missense probably benign 0.12
IGL02651:Rptor APN 11 119,783,438 (GRCm39) missense possibly damaging 0.69
IGL03182:Rptor APN 11 119,615,971 (GRCm39) missense probably damaging 1.00
Velocipede UTSW 11 119,786,803 (GRCm39) missense possibly damaging 0.92
R0103:Rptor UTSW 11 119,775,793 (GRCm39) missense probably benign 0.01
R0179:Rptor UTSW 11 119,763,193 (GRCm39) missense probably benign 0.14
R0217:Rptor UTSW 11 119,785,738 (GRCm39) splice site probably benign
R0219:Rptor UTSW 11 119,712,603 (GRCm39) intron probably benign
R0324:Rptor UTSW 11 119,783,467 (GRCm39) missense probably damaging 1.00
R0432:Rptor UTSW 11 119,671,379 (GRCm39) nonsense probably null
R0718:Rptor UTSW 11 119,763,202 (GRCm39) missense probably benign 0.15
R0730:Rptor UTSW 11 119,775,780 (GRCm39) missense probably benign 0.06
R1019:Rptor UTSW 11 119,734,569 (GRCm39) missense probably damaging 1.00
R1073:Rptor UTSW 11 119,634,717 (GRCm39) missense possibly damaging 0.93
R1424:Rptor UTSW 11 119,671,419 (GRCm39) nonsense probably null
R1579:Rptor UTSW 11 119,786,827 (GRCm39) missense probably benign 0.00
R1766:Rptor UTSW 11 119,615,887 (GRCm39) missense probably damaging 0.99
R1844:Rptor UTSW 11 119,647,146 (GRCm39) missense probably damaging 1.00
R2180:Rptor UTSW 11 119,615,970 (GRCm39) missense probably damaging 1.00
R2274:Rptor UTSW 11 119,647,148 (GRCm39) nonsense probably null
R2275:Rptor UTSW 11 119,647,148 (GRCm39) nonsense probably null
R2408:Rptor UTSW 11 119,748,277 (GRCm39) missense probably damaging 0.99
R2981:Rptor UTSW 11 119,756,420 (GRCm39) missense probably damaging 1.00
R2996:Rptor UTSW 11 119,747,124 (GRCm39) missense probably damaging 1.00
R3001:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R3002:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R3003:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R4358:Rptor UTSW 11 119,562,171 (GRCm39) missense probably damaging 0.98
R4592:Rptor UTSW 11 119,689,666 (GRCm39) missense probably null 1.00
R4647:Rptor UTSW 11 119,781,989 (GRCm39) missense probably benign 0.33
R4666:Rptor UTSW 11 119,634,708 (GRCm39) missense probably damaging 1.00
R4958:Rptor UTSW 11 119,748,217 (GRCm39) missense probably benign 0.29
R4974:Rptor UTSW 11 119,712,466 (GRCm39) intron probably benign
R5073:Rptor UTSW 11 119,787,305 (GRCm39) missense possibly damaging 0.71
R5199:Rptor UTSW 11 119,494,642 (GRCm39) missense probably benign
R5216:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5219:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5277:Rptor UTSW 11 119,713,782 (GRCm39) missense probably damaging 1.00
R5365:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5366:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5447:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5630:Rptor UTSW 11 119,647,075 (GRCm39) missense probably benign 0.01
R6220:Rptor UTSW 11 119,788,268 (GRCm39) missense possibly damaging 0.83
R6741:Rptor UTSW 11 119,786,803 (GRCm39) missense possibly damaging 0.92
R6915:Rptor UTSW 11 119,647,171 (GRCm39) missense probably damaging 0.99
R7032:Rptor UTSW 11 119,737,762 (GRCm39) missense probably benign 0.00
R7051:Rptor UTSW 11 119,765,012 (GRCm39) utr 3 prime probably benign
R7396:Rptor UTSW 11 119,763,181 (GRCm39) missense probably benign 0.10
R7429:Rptor UTSW 11 119,737,654 (GRCm39) missense probably damaging 1.00
R7430:Rptor UTSW 11 119,737,654 (GRCm39) missense probably damaging 1.00
R7447:Rptor UTSW 11 119,775,805 (GRCm39) missense probably benign 0.00
R7595:Rptor UTSW 11 119,634,779 (GRCm39) missense possibly damaging 0.82
R7776:Rptor UTSW 11 119,783,453 (GRCm39) missense probably benign 0.01
R7854:Rptor UTSW 11 119,748,779 (GRCm39) missense probably benign 0.02
R8288:Rptor UTSW 11 119,748,763 (GRCm39) missense probably benign 0.02
R8305:Rptor UTSW 11 119,702,812 (GRCm39) missense probably damaging 1.00
R8328:Rptor UTSW 11 119,783,473 (GRCm39) missense probably benign 0.00
R8351:Rptor UTSW 11 119,783,465 (GRCm39) missense probably benign 0.22
R8772:Rptor UTSW 11 119,615,858 (GRCm39) missense probably damaging 1.00
R8871:Rptor UTSW 11 119,494,751 (GRCm39) missense probably benign 0.01
R8925:Rptor UTSW 11 119,782,036 (GRCm39) missense probably benign 0.11
R8927:Rptor UTSW 11 119,782,036 (GRCm39) missense probably benign 0.11
R8981:Rptor UTSW 11 119,734,508 (GRCm39) missense possibly damaging 0.90
R9149:Rptor UTSW 11 119,777,896 (GRCm39) missense probably benign 0.05
R9213:Rptor UTSW 11 119,494,765 (GRCm39) missense probably benign
R9224:Rptor UTSW 11 119,785,113 (GRCm39) missense probably benign 0.11
R9290:Rptor UTSW 11 119,702,823 (GRCm39) missense probably benign 0.00
R9314:Rptor UTSW 11 119,786,772 (GRCm39) missense probably benign 0.43
R9371:Rptor UTSW 11 119,562,152 (GRCm39) missense possibly damaging 0.66
R9719:Rptor UTSW 11 119,781,940 (GRCm39) missense probably benign 0.13
R9751:Rptor UTSW 11 119,777,964 (GRCm39) missense probably benign 0.02
X0050:Rptor UTSW 11 119,737,231 (GRCm39) missense probably benign 0.14
X0066:Rptor UTSW 11 119,748,692 (GRCm39) missense probably benign 0.31
Z0001:Rptor UTSW 11 119,762,318 (GRCm39) critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119,748,279 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,742,294 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,737,578 (GRCm39) critical splice acceptor site probably null
Z0001:Rptor UTSW 11 119,690,145 (GRCm39) critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119,647,241 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,647,062 (GRCm39) splice site probably null
Z0001:Rptor UTSW 11 119,494,798 (GRCm39) critical splice donor site probably null
Z0001:Rptor UTSW 11 119,787,375 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,764,977 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGTTATGCCATCCTTCAG -3'
(R):5'- TCTCAAAGCTGGATAAGGCAG -3'

Sequencing Primer
(F):5'- AGTTATGCCATCCTTCAGAGCCAG -3'
(R):5'- TAAGGCAGGGGAGACATCTTTTG -3'
Posted On 2018-06-06