Incidental Mutation 'R6490:Axin1'
ID522827
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6490 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26142994 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 104 (I104N)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]
Predicted Effect probably damaging
Transcript: ENSMUST00000074370
AA Change: I104N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: I104N

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118904
AA Change: I104N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: I104N

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163421
AA Change: I104N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: I104N

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168282
SMART Domains Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
coiled coil region 126 154 N/A INTRINSIC
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T G 8: 121,540,554 K38T probably benign Het
4932415D10Rik A T 10: 82,289,304 L2624Q possibly damaging Het
Abca13 A G 11: 9,298,661 T2803A probably benign Het
Adam23 A G 1: 63,557,454 D565G probably damaging Het
Adcy3 A G 12: 4,212,150 T1067A probably damaging Het
Agrn A T 4: 156,167,362 Y1921* probably null Het
Apc2 A G 10: 80,313,923 N1604D probably benign Het
Atxn7 A T 14: 14,089,446 R321* probably null Het
Bahd1 T C 2: 118,917,138 S413P probably benign Het
Baz2b C T 2: 59,901,729 C2024Y probably damaging Het
Cacna1i T A 15: 80,378,247 V1388E probably damaging Het
Ccdc129 A G 6: 55,976,420 D907G probably damaging Het
Ces4a G A 8: 105,149,458 V544M probably benign Het
Cntn3 G A 6: 102,278,340 T199I probably damaging Het
Col6a4 A T 9: 106,074,992 L569* probably null Het
Ctnna2 A G 6: 77,143,909 I12T probably benign Het
Dhx37 A G 5: 125,419,132 M754T probably benign Het
Dmrt1 T A 19: 25,546,031 S249T possibly damaging Het
Ell G T 8: 70,572,903 S59I probably damaging Het
Fam89a G A 8: 124,741,243 S110F probably damaging Het
Fer1l4 A C 2: 156,047,914 F278V possibly damaging Het
Fyn T C 10: 39,551,402 I427T probably damaging Het
Galnt14 T C 17: 73,525,370 D250G probably damaging Het
Glp1r T C 17: 30,924,572 V194A probably damaging Het
Glt1d1 T A 5: 127,644,296 probably null Het
Gm7995 A G 14: 42,311,370 K69R probably benign Het
Grip1 A G 10: 119,986,424 T379A possibly damaging Het
Gtpbp2 G T 17: 46,168,221 A570S probably benign Het
Hmcn1 T C 1: 150,583,278 I5192V probably benign Het
Igfl3 A T 7: 18,179,919 I65F possibly damaging Het
Igsf10 G T 3: 59,329,571 T1063K probably benign Het
Itfg1 A G 8: 85,740,301 V381A probably benign Het
Jmjd8 T A 17: 25,829,112 V16E probably benign Het
Kank1 A G 19: 25,410,085 Y374C probably damaging Het
Kcnma1 C T 14: 23,336,097 V891I possibly damaging Het
Kif20a C A 18: 34,629,490 T472K possibly damaging Het
Klhl32 A T 4: 24,711,578 probably benign Het
Lrrc37a A G 11: 103,456,660 S3070P unknown Het
Mettl21e T G 1: 44,210,265 Y77S probably damaging Het
Mlst8 G T 17: 24,477,961 D82E probably benign Het
Mrgprx2 A T 7: 48,482,869 L67Q probably damaging Het
Mylk T A 16: 34,929,867 L1192Q possibly damaging Het
Myt1l A T 12: 29,832,366 Y520F unknown Het
Naip2 A T 13: 100,160,685 W948R probably benign Het
Nlrp9a A C 7: 26,550,886 K25N probably damaging Het
Nsd3 T C 8: 25,714,185 C414R probably damaging Het
Oit3 A T 10: 59,438,552 V142D possibly damaging Het
Olfr171 C T 16: 19,624,444 V219M probably benign Het
P2ry6 T C 7: 100,938,373 T260A probably damaging Het
Papola A G 12: 105,804,937 Q87R probably benign Het
Pla2g4a T A 1: 149,851,335 R557* probably null Het
Rgs13 G T 1: 144,140,838 H56N probably damaging Het
Sbf1 T C 15: 89,304,908 S537G probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Stam2 T C 2: 52,720,942 T23A probably benign Het
Tbl1xr1 C A 3: 22,203,977 H467Q probably damaging Het
Tmem131l A G 3: 83,913,280 S1222P possibly damaging Het
Tmem43 T A 6: 91,486,880 I379N possibly damaging Het
Tmem43 G T 6: 91,478,777 Q123H probably damaging Het
Trim43c A T 9: 88,844,950 I277F possibly damaging Het
Ttn A G 2: 76,872,867 probably benign Het
Vmn1r75 T A 7: 11,881,076 V245D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps53 A T 11: 76,077,055 M414K probably benign Het
Wrn T G 8: 33,319,220 L249F probably benign Het
Zc3h13 TGATGTCCGGGATGTCCGGGATGTCCGGGATGTCCGGGATGT TGATGTCCGGGATGTCCGGGATGTCCGGGATGT 14: 75,323,558 probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp619 G A 7: 39,534,162 G60R probably benign Het
Zfp623 T A 15: 75,948,459 H421Q probably damaging Het
Zfp827 A G 8: 79,189,977 probably benign Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3051:Axin1 UTSW 17 26190125 missense probably benign 0.01
R3413:Axin1 UTSW 17 26188038 missense probably damaging 0.99
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4530:Axin1 UTSW 17 26188172 missense probably benign 0.09
R4560:Axin1 UTSW 17 26173771 missense probably damaging 1.00
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5299:Axin1 UTSW 17 26173734 missense probably damaging 0.99
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5690:Axin1 UTSW 17 26194937 missense probably damaging 1.00
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6108:Axin1 UTSW 17 26143240 missense probably damaging 0.98
R6282:Axin1 UTSW 17 26143037 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACAGTTTCTGTTCTGGG -3'
(R):5'- GCTGCTTCATGACACAGTCC -3'

Sequencing Primer
(F):5'- CACAGTTTCTGTTCTGGGAAAGGTAC -3'
(R):5'- TTGTCTGGACACAATGCCATTG -3'
Posted On2018-06-06