Incidental Mutation 'R6494:Serpinb7'
ID522910
Institutional Source Beutler Lab
Gene Symbol Serpinb7
Ensembl Gene ENSMUSG00000067001
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 7
Synonymsmegsin, 4631416M05Rik, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6494 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107399655-107452689 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 107435346 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 80 (L80*)
Ref Sequence ENSEMBL: ENSMUSP00000119217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086690] [ENSMUST00000154538]
Predicted Effect probably null
Transcript: ENSMUST00000086690
AA Change: L80*
SMART Domains Protein: ENSMUSP00000083896
Gene: ENSMUSG00000067001
AA Change: L80*

DomainStartEndE-ValueType
SERPIN 13 380 2.7e-121 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154538
AA Change: L80*
SMART Domains Protein: ENSMUSP00000119217
Gene: ENSMUSG00000067001
AA Change: L80*

DomainStartEndE-ValueType
Pfam:Serpin 6 97 4.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158653
Meta Mutation Damage Score 0.6508 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins which function as protease inhibitors. Expression of this gene is upregulated in IgA nephropathy and mutations have been found to cause palmoplantar keratoderma, Nagashima type. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Serpinb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Serpinb7 APN 1 107428246 utr 5 prime probably benign
IGL01325:Serpinb7 APN 1 107435380 missense probably damaging 0.98
IGL01595:Serpinb7 APN 1 107428322 missense probably damaging 0.97
IGL01925:Serpinb7 APN 1 107451669 missense probably benign 0.01
IGL02008:Serpinb7 APN 1 107448129 missense possibly damaging 0.51
IGL02206:Serpinb7 APN 1 107435372 missense possibly damaging 0.88
IGL02870:Serpinb7 APN 1 107450287 missense probably damaging 1.00
IGL03010:Serpinb7 APN 1 107452011 utr 3 prime probably benign
R0455:Serpinb7 UTSW 1 107451610 missense possibly damaging 0.91
R0492:Serpinb7 UTSW 1 107452007 makesense probably null
R0664:Serpinb7 UTSW 1 107428307 missense probably damaging 0.98
R1495:Serpinb7 UTSW 1 107451660 nonsense probably null
R1540:Serpinb7 UTSW 1 107428268 missense possibly damaging 0.72
R1789:Serpinb7 UTSW 1 107450273 missense possibly damaging 0.58
R1850:Serpinb7 UTSW 1 107428295 missense probably damaging 1.00
R2962:Serpinb7 UTSW 1 107451726 missense probably benign 0.00
R3151:Serpinb7 UTSW 1 107435351 nonsense probably null
R3439:Serpinb7 UTSW 1 107428351 missense probably damaging 1.00
R4064:Serpinb7 UTSW 1 107446036 missense probably benign 0.09
R4590:Serpinb7 UTSW 1 107451833 missense probably damaging 1.00
R5260:Serpinb7 UTSW 1 107434749 missense possibly damaging 0.74
R5637:Serpinb7 UTSW 1 107428307 missense probably damaging 1.00
R5914:Serpinb7 UTSW 1 107451850 missense probably damaging 1.00
R5992:Serpinb7 UTSW 1 107445996 missense probably damaging 1.00
R6013:Serpinb7 UTSW 1 107450189 missense probably benign
R6317:Serpinb7 UTSW 1 107451706 missense probably damaging 1.00
R7181:Serpinb7 UTSW 1 107450322 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACACTGATAAGTATGAGGATTTGC -3'
(R):5'- GTTGAACACCATAGCAGCATC -3'

Sequencing Primer
(F):5'- ATAAGTATGAGGATTTGCTTGCTG -3'
(R):5'- TTATGCCTCATAGGAAGGTAAAAGAC -3'
Posted On2018-06-06