Incidental Mutation 'R6494:Lax1'
ID522912
Institutional Source Beutler Lab
Gene Symbol Lax1
Ensembl Gene ENSMUSG00000051998
Gene Namelymphocyte transmembrane adaptor 1
SynonymsE430019B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6494 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133679091-133690108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133680448 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 185 (Y185F)
Ref Sequence ENSEMBL: ENSMUSP00000131126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169295] [ENSMUST00000189524]
Predicted Effect probably damaging
Transcript: ENSMUST00000169295
AA Change: Y185F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131126
Gene: ENSMUSG00000051998
AA Change: Y185F

DomainStartEndE-ValueType
Pfam:LAX 27 378 2.4e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189524
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit spontaneous germinal center formation and increased IgG1, IgG2a, and IgE levels. T and B cells are hyperresponsive upon engagement of T or B AgRs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Lax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Lax1 APN 1 133680399 missense probably benign 0.09
IGL01568:Lax1 APN 1 133680300 missense probably benign 0.00
IGL02352:Lax1 APN 1 133680470 missense possibly damaging 0.95
IGL02359:Lax1 APN 1 133680470 missense possibly damaging 0.95
IGL02449:Lax1 APN 1 133680136 missense probably damaging 0.98
yon UTSW 1 133683036 missense probably benign 0.20
R0391:Lax1 UTSW 1 133680066 missense probably benign 0.24
R1728:Lax1 UTSW 1 133679978 missense probably benign
R1728:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1728:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1729:Lax1 UTSW 1 133679978 missense probably benign
R1729:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1729:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1730:Lax1 UTSW 1 133679978 missense probably benign
R1730:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1730:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1739:Lax1 UTSW 1 133679978 missense probably benign
R1739:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1739:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1762:Lax1 UTSW 1 133679978 missense probably benign
R1762:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1762:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1783:Lax1 UTSW 1 133679978 missense probably benign
R1783:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1783:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1784:Lax1 UTSW 1 133679978 missense probably benign
R1784:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1784:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1785:Lax1 UTSW 1 133679978 missense probably benign
R1785:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1785:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R2254:Lax1 UTSW 1 133680233 missense probably damaging 0.99
R2906:Lax1 UTSW 1 133688905 start codon destroyed probably null 0.53
R2912:Lax1 UTSW 1 133684053 missense possibly damaging 0.77
R4022:Lax1 UTSW 1 133683036 missense probably benign 0.20
R5234:Lax1 UTSW 1 133680583 missense probably benign 0.02
R5686:Lax1 UTSW 1 133680176 missense probably damaging 1.00
R5695:Lax1 UTSW 1 133680578 missense probably damaging 1.00
R6003:Lax1 UTSW 1 133684096 missense probably benign 0.24
R6362:Lax1 UTSW 1 133680596 missense possibly damaging 0.92
R6493:Lax1 UTSW 1 133679792 missense probably benign
R6932:Lax1 UTSW 1 133680158 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ATCACTGCACTTGGGTCCTG -3'
(R):5'- TGTGAGCCTCTGACTTGGAG -3'

Sequencing Primer
(F):5'- GGGTCCTGGAGCCCAAAAAC -3'
(R):5'- CAAGCCAATGGTTCCCTTCAGATG -3'
Posted On2018-06-06