Incidental Mutation 'R6492:A2m'
ID522961
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6492 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121654505 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 587 (T587I)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
Predicted Effect probably benign
Transcript: ENSMUST00000032203
AA Change: T587I

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: T587I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203413
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,801,655 M1062K probably benign Het
Agbl4 G A 4: 111,547,272 D272N probably damaging Het
Apob A T 12: 8,008,261 I2215F probably damaging Het
Atp10b A T 11: 43,218,957 Q821H probably damaging Het
Atp1a3 T C 7: 24,979,304 Y971C probably damaging Het
Atp6ap1l A T 13: 90,883,722 H280Q probably damaging Het
B4galt2 A T 4: 117,876,967 M291K probably damaging Het
Cachd1 G T 4: 100,952,118 V267F possibly damaging Het
Cadm2 G T 16: 66,784,828 L188M probably damaging Het
Ceacam19 T C 7: 19,882,592 N199S probably benign Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Cluap1 T A 16: 3,928,612 M279K probably benign Het
Cngb1 T A 8: 95,264,424 M717L probably benign Het
Cp T C 3: 19,982,022 V777A probably benign Het
Drosha A G 15: 12,861,706 D594G probably benign Het
Exo5 A G 4: 120,921,537 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gprc5b A G 7: 118,984,577 I23T possibly damaging Het
Ikbke T C 1: 131,259,218 Y579C probably damaging Het
Ikzf2 T C 1: 69,539,042 Y362C probably damaging Het
Itfg1 A G 8: 85,740,349 V365A probably benign Het
Josd2 T C 7: 44,471,154 I105T probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Mettl22 T A 16: 8,488,891 probably null Het
Mgat5 A G 1: 127,471,564 I619V probably benign Het
Nin T C 12: 70,054,534 I430V probably benign Het
Olfr1047 T A 2: 86,228,387 I195F possibly damaging Het
Olfr1052 T C 2: 86,298,646 F277L probably benign Het
Olfr153 C G 2: 87,532,741 A236G possibly damaging Het
Olfr221 A G 14: 52,035,445 F222S probably benign Het
Olfr668 C A 7: 104,925,645 A40S possibly damaging Het
Parvb T C 15: 84,303,872 L272P probably damaging Het
Pde2a A G 7: 101,500,442 K180E possibly damaging Het
Pik3c3 C T 18: 30,324,562 T736M probably damaging Het
Plcb4 C T 2: 135,973,071 R760* probably null Het
Pramel6 C T 2: 87,510,422 T366I probably benign Het
Prr29 C T 11: 106,375,236 R42W probably damaging Het
Prss12 A G 3: 123,447,399 I81V probably benign Het
Ptpn13 A G 5: 103,501,612 T294A probably benign Het
Ptprc A T 1: 138,113,562 probably null Het
Sin3b T A 8: 72,733,490 probably null Het
Slco5a1 T C 1: 12,989,927 Y190C probably damaging Het
Slco6c1 T G 1: 97,125,813 Y121S probably damaging Het
Srcap G T 7: 127,522,145 G217* probably null Het
Ss18 A T 18: 14,651,088 M181K probably damaging Het
Synm T C 7: 67,736,061 T176A probably benign Het
Taf3 T C 2: 9,951,160 E579G probably damaging Het
Taf7 A G 18: 37,643,106 I136T probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tyrp1 A G 4: 80,840,781 D297G probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Wisp3 C T 10: 39,154,987 G180D probably benign Het
Wwp1 G A 4: 19,650,299 S289L possibly damaging Het
Xbp1 T C 11: 5,521,005 V4A probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb2 T C 10: 4,369,711 Y105C probably damaging Het
Zeb2 T C 2: 45,110,496 probably benign Het
Zkscan8 A T 13: 21,525,227 I167N probably benign Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3437:A2m UTSW 6 121639294 missense probably null 0.03
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGGCCAGTTTGGGAAGC -3'
(R):5'- ACAGGTCTTGCATTACTCAAGC -3'

Sequencing Primer
(F):5'- ACCATGACAGTTGTCTGACAG -3'
(R):5'- CAGGTCTTGCATTACTCAAGCAATTC -3'
Posted On2018-06-06