Incidental Mutation 'R6492:Josd2'
ID522968
Institutional Source Beutler Lab
Gene Symbol Josd2
Ensembl Gene ENSMUSG00000038695
Gene NameJosephin domain containing 2
Synonyms1110007C05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6492 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44467980-44471662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44471154 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 105 (I105T)
Ref Sequence ENSEMBL: ENSMUSP00000114105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035844] [ENSMUST00000035929] [ENSMUST00000117324] [ENSMUST00000118493] [ENSMUST00000118628] [ENSMUST00000120852] [ENSMUST00000121922] [ENSMUST00000134398] [ENSMUST00000135624] [ENSMUST00000136609] [ENSMUST00000136679] [ENSMUST00000146128] [ENSMUST00000152902] [ENSMUST00000156957] [ENSMUST00000206887] [ENSMUST00000208117]
Predicted Effect probably damaging
Transcript: ENSMUST00000035844
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048415
Gene: ENSMUSG00000038695
AA Change: I105T

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117324
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113313
Gene: ENSMUSG00000038695
AA Change: I105T

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118493
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113226
Gene: ENSMUSG00000038695
AA Change: I105T

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118628
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113172
Gene: ENSMUSG00000038695
AA Change: I105T

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120852
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114105
Gene: ENSMUSG00000038695
AA Change: I105T

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121922
AA Change: I63T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112796
Gene: ENSMUSG00000038695
AA Change: I63T

DomainStartEndE-ValueType
Josephin 18 134 7e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000134398
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000136609
SMART Domains Protein: ENSMUSP00000123205
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 97 7.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136679
SMART Domains Protein: ENSMUSP00000114900
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Pfam:Josephin 18 61 3.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139097
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149341
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155659
Predicted Effect probably benign
Transcript: ENSMUST00000156957
SMART Domains Protein: ENSMUSP00000121766
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:DUF108 52 151 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206210
Predicted Effect probably benign
Transcript: ENSMUST00000206887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207591
Predicted Effect probably benign
Transcript: ENSMUST00000208117
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,654,505 T587I probably benign Het
Abl1 T A 2: 31,801,655 M1062K probably benign Het
Agbl4 G A 4: 111,547,272 D272N probably damaging Het
Apob A T 12: 8,008,261 I2215F probably damaging Het
Atp10b A T 11: 43,218,957 Q821H probably damaging Het
Atp1a3 T C 7: 24,979,304 Y971C probably damaging Het
Atp6ap1l A T 13: 90,883,722 H280Q probably damaging Het
B4galt2 A T 4: 117,876,967 M291K probably damaging Het
Cachd1 G T 4: 100,952,118 V267F possibly damaging Het
Cadm2 G T 16: 66,784,828 L188M probably damaging Het
Ceacam19 T C 7: 19,882,592 N199S probably benign Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Cluap1 T A 16: 3,928,612 M279K probably benign Het
Cngb1 T A 8: 95,264,424 M717L probably benign Het
Cp T C 3: 19,982,022 V777A probably benign Het
Drosha A G 15: 12,861,706 D594G probably benign Het
Exo5 A G 4: 120,921,537 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gprc5b A G 7: 118,984,577 I23T possibly damaging Het
Ikbke T C 1: 131,259,218 Y579C probably damaging Het
Ikzf2 T C 1: 69,539,042 Y362C probably damaging Het
Itfg1 A G 8: 85,740,349 V365A probably benign Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Mettl22 T A 16: 8,488,891 probably null Het
Mgat5 A G 1: 127,471,564 I619V probably benign Het
Nin T C 12: 70,054,534 I430V probably benign Het
Olfr1047 T A 2: 86,228,387 I195F possibly damaging Het
Olfr1052 T C 2: 86,298,646 F277L probably benign Het
Olfr153 C G 2: 87,532,741 A236G possibly damaging Het
Olfr221 A G 14: 52,035,445 F222S probably benign Het
Olfr668 C A 7: 104,925,645 A40S possibly damaging Het
Parvb T C 15: 84,303,872 L272P probably damaging Het
Pde2a A G 7: 101,500,442 K180E possibly damaging Het
Pik3c3 C T 18: 30,324,562 T736M probably damaging Het
Plcb4 C T 2: 135,973,071 R760* probably null Het
Pramel6 C T 2: 87,510,422 T366I probably benign Het
Prr29 C T 11: 106,375,236 R42W probably damaging Het
Prss12 A G 3: 123,447,399 I81V probably benign Het
Ptpn13 A G 5: 103,501,612 T294A probably benign Het
Ptprc A T 1: 138,113,562 probably null Het
Sin3b T A 8: 72,733,490 probably null Het
Slco5a1 T C 1: 12,989,927 Y190C probably damaging Het
Slco6c1 T G 1: 97,125,813 Y121S probably damaging Het
Srcap G T 7: 127,522,145 G217* probably null Het
Ss18 A T 18: 14,651,088 M181K probably damaging Het
Synm T C 7: 67,736,061 T176A probably benign Het
Taf3 T C 2: 9,951,160 E579G probably damaging Het
Taf7 A G 18: 37,643,106 I136T probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tyrp1 A G 4: 80,840,781 D297G probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Wisp3 C T 10: 39,154,987 G180D probably benign Het
Wwp1 G A 4: 19,650,299 S289L possibly damaging Het
Xbp1 T C 11: 5,521,005 V4A probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb2 T C 10: 4,369,711 Y105C probably damaging Het
Zeb2 T C 2: 45,110,496 probably benign Het
Zkscan8 A T 13: 21,525,227 I167N probably benign Het
Other mutations in Josd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Josd2 APN 7 44471316 unclassified probably benign
IGL03029:Josd2 APN 7 44471177 missense probably damaging 0.98
R1376:Josd2 UTSW 7 44471115 missense probably damaging 1.00
R1376:Josd2 UTSW 7 44471115 missense probably damaging 1.00
R1782:Josd2 UTSW 7 44471153 missense probably damaging 1.00
R2849:Josd2 UTSW 7 44468973 splice site probably null
R4739:Josd2 UTSW 7 44471254 missense probably damaging 1.00
R4944:Josd2 UTSW 7 44471168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACCAAAGCTGGAGTTGAC -3'
(R):5'- ATCTCCTTGCAGGGCAGTTC -3'

Sequencing Primer
(F):5'- CCAAAGCTGGAGTTGACAGATAAG -3'
(R):5'- CTTGCAGGGCAGTTCCAGTG -3'
Posted On2018-06-06