Incidental Mutation 'R6496:Kera'
ID523029
Institutional Source Beutler Lab
Gene Symbol Kera
Ensembl Gene ENSMUSG00000019932
Gene Namekeratocan
SynonymsSLRR2B, CNA2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6496 (G1)
Quality Score171.009
Status Validated
Chromosome10
Chromosomal Location97606879-97613692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97612810 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 297 (N297K)
Ref Sequence ENSEMBL: ENSMUSP00000100923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105286]
Predicted Effect probably benign
Transcript: ENSMUST00000105286
AA Change: N297K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100923
Gene: ENSMUSG00000019932
AA Change: N297K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 42 76 1.9e-14 SMART
LRR 71 90 2.5e-1 SMART
LRR 121 140 2.1e-1 SMART
LRR 142 161 1.5e0 SMART
LRR 166 191 3.4e-2 SMART
LRR 192 215 2.8e-2 SMART
LRR 213 232 9.2e-1 SMART
Blast:LRR 237 261 4e-8 BLAST
LRR 262 281 6.3e-2 SMART
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a keratan sulfate proteoglycan that is involved in corneal transparency. Defects in this gene are a cause of autosomal recessive cornea plana 2 (CNA2).[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a thinner than normal corneal stroma with thicker collagen fibers which were less regularly packed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,540,406 T79S probably benign Het
4930430A15Rik T A 2: 111,164,472 H232L unknown Het
Atp2b1 T A 10: 99,003,337 C676S probably damaging Het
Atp8b5 T C 4: 43,371,003 F1047L probably benign Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
Casp8ap2 A C 4: 32,641,553 H869P probably benign Het
Cdh26 G A 2: 178,449,861 G71D probably damaging Het
Col4a2 G T 8: 11,402,993 G187* probably null Het
Col4a2 G T 8: 11,402,994 G187V probably damaging Het
Dsn1 A G 2: 157,005,267 S84P probably damaging Het
Edaradd T A 13: 12,478,442 D123V probably damaging Het
Epb41l1 T C 2: 156,533,796 S611P possibly damaging Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fam217a G A 13: 34,910,802 R234* probably null Het
Gm17175 A G 14: 51,573,077 I31T probably benign Het
Jtb T C 3: 90,233,957 V80A possibly damaging Het
Klhl1 T C 14: 96,240,216 N472S probably benign Het
Lgmn T C 12: 102,398,239 T324A probably benign Het
Ndst3 A G 3: 123,552,552 I276T probably damaging Het
Nsd2 A G 5: 33,843,513 K125E probably damaging Het
Olfr1129 A C 2: 87,575,116 N11H probably damaging Het
Olfr820 T A 10: 130,017,579 S73T probably benign Het
Patj C A 4: 98,416,752 A281E probably damaging Het
Pcdha7 A G 18: 36,974,585 E221G possibly damaging Het
Plcd1 A G 9: 119,072,641 F605S possibly damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Pmfbp1 A G 8: 109,532,157 K698R probably null Het
Psd G A 19: 46,320,314 R628C probably damaging Het
Sipa1l2 T C 8: 125,449,894 N1211S probably benign Het
Slc1a3 T A 15: 8,649,581 M177L probably benign Het
Slc34a1 T C 13: 55,402,682 S183P probably benign Het
Spata22 G A 11: 73,340,363 G148R probably damaging Het
Tfap2a T C 13: 40,728,775 D18G probably damaging Het
Thoc7 T C 14: 13,954,593 N28S possibly damaging Het
Usp42 T C 5: 143,715,103 Y1055C probably damaging Het
Zfp874a A G 13: 67,442,575 V330A possibly damaging Het
Other mutations in Kera
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kera APN 10 97609077 missense possibly damaging 0.79
R1309:Kera UTSW 10 97609426 missense possibly damaging 0.82
R1830:Kera UTSW 10 97609147 missense probably benign 0.29
R1895:Kera UTSW 10 97609147 missense probably benign 0.29
R1946:Kera UTSW 10 97609147 missense probably benign 0.29
R2365:Kera UTSW 10 97608943 missense probably benign 0.44
R3957:Kera UTSW 10 97612845 missense probably benign
R4198:Kera UTSW 10 97612973 makesense probably null
R4624:Kera UTSW 10 97609631 missense probably benign 0.00
R4625:Kera UTSW 10 97609631 missense probably benign 0.00
R4628:Kera UTSW 10 97609631 missense probably benign 0.00
R4629:Kera UTSW 10 97609631 missense probably benign 0.00
R4640:Kera UTSW 10 97612887 missense probably damaging 1.00
R6767:Kera UTSW 10 97609172 missense possibly damaging 0.92
R6999:Kera UTSW 10 97608952 missense probably damaging 1.00
R7017:Kera UTSW 10 97609077 missense possibly damaging 0.79
R7117:Kera UTSW 10 97612852 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAAGGAGCTGTTAGTTCAAC -3'
(R):5'- CCTTAAACCAGTTTGGGTTCTG -3'

Sequencing Primer
(F):5'- GAGCTGTTAGTTCAACATCCTTTCAG -3'
(R):5'- GGGTTCTGTCTTATATTATGAAAGCC -3'
Posted On2018-06-06