Incidental Mutation 'R6498:Tekt2'
ID523094
Institutional Source Beutler Lab
Gene Symbol Tekt2
Ensembl Gene ENSMUSG00000028845
Gene Nametektin 2
Synonymstektin-t
MMRRC Submission
Accession Numbers

Genbank: NM_011902.2; Ensembl: ENSMUST00000102616

Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126322121-126325688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126324305 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 138 (L138P)
Ref Sequence ENSEMBL: ENSMUSP00000099676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000102616] [ENSMUST00000102617] [ENSMUST00000131113] [ENSMUST00000141990]
Predicted Effect probably benign
Transcript: ENSMUST00000030658
AA Change: L138P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845
AA Change: L138P

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102616
AA Change: L138P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845
AA Change: L138P

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128188
Predicted Effect probably benign
Transcript: ENSMUST00000131113
SMART Domains Protein: ENSMUSP00000116659
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 126 9.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140080
Predicted Effect probably benign
Transcript: ENSMUST00000141990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156139
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is expressed in the testis and its protein is localized to the flagella of the sperms, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit male infertility and impaired motility of both sperm flagella and tracheal cilia due to altered dynein inner arm morphology and function. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Tekt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tekt2 APN 4 126323189 missense possibly damaging 0.47
IGL01900:Tekt2 APN 4 126324628 missense probably benign 0.00
IGL02452:Tekt2 APN 4 126324852 missense possibly damaging 0.83
IGL02563:Tekt2 APN 4 126324625 missense possibly damaging 0.82
IGL03087:Tekt2 APN 4 126324867 missense possibly damaging 0.63
1mM(1):Tekt2 UTSW 4 126324610 missense probably damaging 0.98
R0747:Tekt2 UTSW 4 126323760 nonsense probably null
R1113:Tekt2 UTSW 4 126324918 missense probably damaging 0.99
R1308:Tekt2 UTSW 4 126324918 missense probably damaging 0.99
R1524:Tekt2 UTSW 4 126323649 missense probably benign
R1563:Tekt2 UTSW 4 126323407 missense probably benign 0.16
R1819:Tekt2 UTSW 4 126323736 missense probably damaging 1.00
R1930:Tekt2 UTSW 4 126322817 splice site probably null
R1931:Tekt2 UTSW 4 126322817 splice site probably null
R2295:Tekt2 UTSW 4 126323693 unclassified probably null
R4888:Tekt2 UTSW 4 126324667 missense probably benign 0.02
R4902:Tekt2 UTSW 4 126323470 missense possibly damaging 0.95
R5202:Tekt2 UTSW 4 126324670 missense probably benign 0.41
R5219:Tekt2 UTSW 4 126322264 missense possibly damaging 0.51
R5839:Tekt2 UTSW 4 126322836 missense probably damaging 1.00
R6213:Tekt2 UTSW 4 126323196 missense probably damaging 0.99
R6963:Tekt2 UTSW 4 126324317 missense probably damaging 0.98
R6988:Tekt2 UTSW 4 126323443 missense probably benign 0.02
R7148:Tekt2 UTSW 4 126322381 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GACCAATATCTCCTGCCAGAAGG -3'
(R):5'- GATCTGGACACCATTCCCTCTG -3'

Sequencing Primer
(F):5'- CCAGAAGGCTGTGAGGGAC -3'
(R):5'- GGACACCATTCCCTCTGCTGAG -3'
Posted On2018-06-06