Incidental Mutation 'R6498:Per3'
ID523098
Institutional Source Beutler Lab
Gene Symbol Per3
Ensembl Gene ENSMUSG00000028957
Gene Nameperiod circadian clock 3
SynonymsmPer3, 2810049O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location151003652-151044665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151029205 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 299 (I299V)
Ref Sequence ENSEMBL: ENSMUSP00000099493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103204] [ENSMUST00000136398] [ENSMUST00000169423]
PDB Structure
Unwinding the Differences of the Mammalian PERIOD Clock Proteins from Crystal Structure to Cellular Function [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000103204
AA Change: I299V

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099493
Gene: ENSMUSG00000028957
AA Change: I299V

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 1.52e-1 SMART
low complexity region 414 427 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Pfam:Period_C 905 1111 4.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128283
Predicted Effect probably benign
Transcript: ENSMUST00000136398
AA Change: I299V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118950
Gene: ENSMUSG00000028957
AA Change: I299V

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 3.25e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138584
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been linked to sleep disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit a shorter circadian cycle length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Per3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Per3 APN 4 151013598 missense probably benign 0.28
IGL02112:Per3 APN 4 151029183 missense probably benign 0.20
IGL02428:Per3 APN 4 151018217 critical splice donor site probably null
IGL02812:Per3 APN 4 151024470 missense probably damaging 0.99
IGL03094:Per3 APN 4 151009298 missense probably damaging 1.00
R0119:Per3 UTSW 4 151024548 intron probably benign
R0565:Per3 UTSW 4 151033952 missense probably damaging 1.00
R0671:Per3 UTSW 4 151028831 missense probably benign 0.27
R1186:Per3 UTSW 4 151026138 missense probably damaging 0.99
R1736:Per3 UTSW 4 151009248 critical splice donor site probably null
R1757:Per3 UTSW 4 151042792 critical splice acceptor site probably null
R1900:Per3 UTSW 4 151041426 missense probably damaging 1.00
R1929:Per3 UTSW 4 151018885 missense probably damaging 1.00
R2044:Per3 UTSW 4 151033938 missense probably benign 0.01
R2272:Per3 UTSW 4 151018885 missense probably damaging 1.00
R2415:Per3 UTSW 4 151012690 missense possibly damaging 0.91
R4771:Per3 UTSW 4 151009259 missense probably damaging 1.00
R5199:Per3 UTSW 4 151012895 missense probably benign 0.15
R5298:Per3 UTSW 4 151029209 missense probably damaging 1.00
R5330:Per3 UTSW 4 151041302 missense probably damaging 1.00
R5331:Per3 UTSW 4 151041302 missense probably damaging 1.00
R5920:Per3 UTSW 4 151012450 missense probably benign 0.05
R5974:Per3 UTSW 4 151042737 missense possibly damaging 0.83
R6907:Per3 UTSW 4 151043558 critical splice donor site probably null
R6915:Per3 UTSW 4 151043649 missense possibly damaging 0.84
R7269:Per3 UTSW 4 151031936 nonsense probably null
R7454:Per3 UTSW 4 151012728 missense probably benign 0.05
R7555:Per3 UTSW 4 151018058 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCATTTCATATTTGGGTAAAGGC -3'
(R):5'- CTCATCGAGAGGAAAGGGTTTG -3'

Sequencing Primer
(F):5'- TTGGGTAAAGGCTAAACTCTAAGC -3'
(R):5'- CAGGAGACAGAATCCTTACGTATGC -3'
Posted On2018-06-06