Incidental Mutation 'R6498:Olfr309'
ID523105
Institutional Source Beutler Lab
Gene Symbol Olfr309
Ensembl Gene ENSMUSG00000054054
Gene Nameolfactory receptor 309
SynonymsGA_x6K02T2NHDJ-9801340-9802266, MOR251-4P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86304474-86313708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86307018 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 32 (I32V)
Ref Sequence ENSEMBL: ENSMUSP00000134377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055690] [ENSMUST00000174158]
Predicted Effect probably benign
Transcript: ENSMUST00000055690
AA Change: I32V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061929
Gene: ENSMUSG00000054054
AA Change: I32V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 303 4.5e-11 PFAM
Pfam:7tm_1 39 288 1.5e-26 PFAM
Pfam:7tm_4 137 281 7.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174158
AA Change: I32V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134377
Gene: ENSMUSG00000054054
AA Change: I32V

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.5e-11 PFAM
Pfam:7tm_1 39 288 2.4e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Olfr309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Olfr309 APN 7 86307051 missense probably damaging 1.00
R0370:Olfr309 UTSW 7 86306849 missense probably benign 0.42
R1869:Olfr309 UTSW 7 86306667 missense possibly damaging 0.96
R2047:Olfr309 UTSW 7 86306804 missense probably damaging 1.00
R3939:Olfr309 UTSW 7 86306229 missense probably benign 0.00
R4562:Olfr309 UTSW 7 86307152 start gained probably benign
R4640:Olfr309 UTSW 7 86307066 missense probably benign 0.01
R4811:Olfr309 UTSW 7 86306958 missense probably benign 0.41
R4867:Olfr309 UTSW 7 86306283 missense probably benign 0.00
R4954:Olfr309 UTSW 7 86306601 missense probably benign 0.01
R5784:Olfr309 UTSW 7 86306535 missense probably damaging 1.00
R6043:Olfr309 UTSW 7 86306339 missense probably damaging 0.97
R6849:Olfr309 UTSW 7 86307040 missense possibly damaging 0.54
R7238:Olfr309 UTSW 7 86306591 missense probably damaging 1.00
T0975:Olfr309 UTSW 7 86306284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGCTGGGACATGCAACC -3'
(R):5'- CCCATCATAGAGAAACTTATGCTAC -3'

Sequencing Primer
(F):5'- TGGGACATGCAACCCCCATATG -3'
(R):5'- TGCATATCATCAGTAGTGAGACATC -3'
Posted On2018-06-06