Incidental Mutation 'R6498:Trim43a'
ID523108
Institutional Source Beutler Lab
Gene Symbol Trim43a
Ensembl Gene ENSMUSG00000090693
Gene Nametripartite motif-containing 43A
SynonymsGm6021
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location88580891-88588819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88582342 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 102 (I102N)
Ref Sequence ENSEMBL: ENSMUSP00000127527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164661] [ENSMUST00000215498] [ENSMUST00000216686]
Predicted Effect probably damaging
Transcript: ENSMUST00000164661
AA Change: I102N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127527
Gene: ENSMUSG00000090693
AA Change: I102N

DomainStartEndE-ValueType
RING 16 56 9.6e-7 SMART
Blast:BBOX 88 129 1e-7 BLAST
PDB:2VOK|B 328 445 5e-14 PDB
Blast:SPRY 335 441 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000215498
Predicted Effect probably benign
Transcript: ENSMUST00000216686
Meta Mutation Damage Score 0.0308 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Trim43a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02400:Trim43a APN 9 88582112 missense probably benign 0.00
IGL02864:Trim43a APN 9 88588112 missense probably benign 0.20
R0114:Trim43a UTSW 9 88584160 missense probably damaging 1.00
R0436:Trim43a UTSW 9 88588187 missense probably damaging 1.00
R0514:Trim43a UTSW 9 88584336 nonsense probably null
R0682:Trim43a UTSW 9 88582146 missense probably benign 0.08
R0709:Trim43a UTSW 9 88582146 missense probably benign 0.08
R0727:Trim43a UTSW 9 88582146 missense probably benign 0.08
R1237:Trim43a UTSW 9 88582989 intron probably benign
R1239:Trim43a UTSW 9 88582989 intron probably benign
R1445:Trim43a UTSW 9 88582989 intron probably benign
R1448:Trim43a UTSW 9 88582093 missense probably damaging 1.00
R1584:Trim43a UTSW 9 88588158 missense probably damaging 1.00
R1925:Trim43a UTSW 9 88582318 missense probably benign 0.08
R1992:Trim43a UTSW 9 88584259 missense probably damaging 1.00
R2074:Trim43a UTSW 9 88586094 missense possibly damaging 0.91
R3927:Trim43a UTSW 9 88582989 intron probably benign
R3930:Trim43a UTSW 9 88583078 missense probably benign 0.04
R4418:Trim43a UTSW 9 88582153 missense probably damaging 1.00
R5488:Trim43a UTSW 9 88582176 missense probably damaging 0.97
R5489:Trim43a UTSW 9 88582176 missense probably damaging 0.97
R6742:Trim43a UTSW 9 88588346 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGGTGTGGCCATAAGTTCTG -3'
(R):5'- AAGCATCTTCCTGTGGTCTGC -3'

Sequencing Primer
(F):5'- CCATAAGTTCTGCGAGGCATGTC -3'
(R):5'- CCTGTGGTCTGCTAAGCC -3'
Posted On2018-06-06