Incidental Mutation 'R6498:Olfr329-ps'
ID523112
Institutional Source Beutler Lab
Gene Symbol Olfr329-ps
Ensembl Gene ENSMUSG00000064252
Gene Nameolfactory receptor 329, pseudogene
SynonymsMOR275-6P, GA_x6K02T2NKPP-882068-883006
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58539801-58546422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58542582 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 298 (N298I)
Ref Sequence ENSEMBL: ENSMUSP00000151648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108822] [ENSMUST00000108823] [ENSMUST00000219448]
Predicted Effect probably damaging
Transcript: ENSMUST00000108822
AA Change: N311I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104450
Gene: ENSMUSG00000064252
AA Change: N311I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108823
AA Change: N298I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104451
Gene: ENSMUSG00000064252
AA Change: N298I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.4e-35 PFAM
Pfam:7tm_4 137 281 5.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219448
AA Change: N298I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Olfr329-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0744:Olfr329-ps UTSW 11 58543162 missense possibly damaging 0.76
R2426:Olfr329-ps UTSW 11 58543094 nonsense probably null
R4805:Olfr329-ps UTSW 11 58542570 missense probably benign 0.03
R7341:Olfr329-ps UTSW 11 58542707 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAACTGGACAGATTACAAGTAG -3'
(R):5'- CTCAGGATGAACTCAGCAGAGG -3'

Sequencing Primer
(F):5'- CACAATGATTCTTCAAAAAGGGATG -3'
(R):5'- CAGGAAGAAGGCCCTTGC -3'
Posted On2018-06-06