Incidental Mutation 'R6498:Wsb1'
ID523114
Institutional Source Beutler Lab
Gene Symbol Wsb1
Ensembl Gene ENSMUSG00000017677
Gene NameWD repeat and SOCS box-containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location79239372-79254671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79248489 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 127 (V127D)
Ref Sequence ENSEMBL: ENSMUSP00000017821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017821] [ENSMUST00000131848] [ENSMUST00000145772]
Predicted Effect probably damaging
Transcript: ENSMUST00000017821
AA Change: V127D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017821
Gene: ENSMUSG00000017677
AA Change: V127D

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-16 BLAST
WD40 117 156 8.4e-2 SMART
WD40 159 199 2.5e-10 SMART
WD40 203 242 5.9e-10 SMART
WD40 245 284 2.9e-11 SMART
WD40 300 339 1.2e-5 SMART
WD40 342 379 1.1e-4 SMART
SOCS 378 420 2.7e-18 SMART
SOCS_box 384 420 4.1e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131818
AA Change: V57D
SMART Domains Protein: ENSMUSP00000131290
Gene: ENSMUSG00000017677
AA Change: V57D

DomainStartEndE-ValueType
WD40 48 87 1.33e1 SMART
WD40 90 130 3.72e-8 SMART
WD40 134 172 4.18e-2 SMART
Predicted Effect silent
Transcript: ENSMUST00000131848
SMART Domains Protein: ENSMUSP00000128181
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137890
Predicted Effect probably benign
Transcript: ENSMUST00000145772
SMART Domains Protein: ENSMUSP00000137999
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 3e-19 BLAST
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-protein subfamily. This protein shares a high sequence identity to mouse and chick proteins. It contains several WD-repeats spanning most of the protein and an SOCS box in the C-terminus. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Other mutations in Wsb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Wsb1 APN 11 79242041 missense probably damaging 1.00
IGL02352:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL02359:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL03218:Wsb1 APN 11 79248498 missense probably damaging 0.97
R0488:Wsb1 UTSW 11 79244500 missense probably damaging 1.00
R1051:Wsb1 UTSW 11 79246233 missense probably damaging 1.00
R1612:Wsb1 UTSW 11 79248585 missense probably benign 0.31
R2202:Wsb1 UTSW 11 79240386 missense probably benign
R2449:Wsb1 UTSW 11 79240352 missense probably benign
R4782:Wsb1 UTSW 11 79240373 missense probably benign 0.44
R4805:Wsb1 UTSW 11 79240391 missense possibly damaging 0.95
R4932:Wsb1 UTSW 11 79251000 missense probably damaging 0.96
R5458:Wsb1 UTSW 11 79248436 missense probably damaging 1.00
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6140:Wsb1 UTSW 11 79241618 missense probably damaging 0.98
R6192:Wsb1 UTSW 11 79248510 missense possibly damaging 0.94
R6545:Wsb1 UTSW 11 79251055 missense probably damaging 1.00
R6608:Wsb1 UTSW 11 79240362 missense probably benign 0.30
R7142:Wsb1 UTSW 11 79250988 missense probably benign 0.01
R7339:Wsb1 UTSW 11 79240358 missense probably damaging 0.97
R7361:Wsb1 UTSW 11 79240797 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGACCCAAACCTGCTTTGC -3'
(R):5'- GAGGGTTCTCAGCCAACAATAG -3'

Sequencing Primer
(F):5'- CCAAACCTGCTTTGCATATTTTATC -3'
(R):5'- GGGTTCTCAGCCAACAATAGTTTTC -3'
Posted On2018-06-06