Incidental Mutation 'R6498:Agtpbp1'
ID523118
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene NameATP/GTP binding protein 1
Synonyms2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59445742-59585227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59477040 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 833 (V833A)
Ref Sequence ENSEMBL: ENSMUSP00000130939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000224397]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022040
AA Change: V833A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: V833A

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163149
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164215
AA Change: V833A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: V833A

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect silent
Transcript: ENSMUST00000168141
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably benign
Transcript: ENSMUST00000170555
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224397
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site probably benign
gru UTSW 13 59473746 missense probably damaging 1.00
rio UTSW 13 59525241 critical splice acceptor site probably benign
wobble UTSW 13 59474550 missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably benign 0.24
R0559:Agtpbp1 UTSW 13 59497000 missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R0943:Agtpbp1 UTSW 13 59500602 missense probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1421:Agtpbp1 UTSW 13 59495575 missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59475803 frame shift probably null
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59528399 missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5824:Agtpbp1 UTSW 13 59466099 missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59504294 missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59466038 missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59533180 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCAACGAGTACTACATCTCTGTTG -3'
(R):5'- AGCAGTTCAGTTAAATGGACTATCC -3'

Sequencing Primer
(F):5'- CGAGTACTACATCTCTGTTGATATGC -3'
(R):5'- GGACTATCCACTGGGGTTTTTC -3'
Posted On2018-06-06