Incidental Mutation 'R6498:Pcdh1'
ID523121
Institutional Source Beutler Lab
Gene Symbol Pcdh1
Ensembl Gene ENSMUSG00000051375
Gene Nameprotocadherin 1
Synonyms2010005A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R6498 (G1)
Quality Score162.009
Status Validated
Chromosome18
Chromosomal Location38185914-38212053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38197437 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 838 (P838S)
Ref Sequence ENSEMBL: ENSMUSP00000125576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057185] [ENSMUST00000159405] [ENSMUST00000160721] [ENSMUST00000161701]
Predicted Effect probably benign
Transcript: ENSMUST00000057185
AA Change: P977S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055199
Gene: ENSMUSG00000051375
AA Change: P977S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159405
AA Change: P977S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125309
Gene: ENSMUSG00000051375
AA Change: P977S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160721
SMART Domains Protein: ENSMUSP00000124732
Gene: ENSMUSG00000051375

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 9.9e-10 PFAM
CA 168 256 5.18e-18 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161701
AA Change: P838S

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125576
Gene: ENSMUSG00000051375
AA Change: P838S

DomainStartEndE-ValueType
CA 29 117 5.18e-18 SMART
CA 141 224 5.68e-24 SMART
CA 256 343 1.84e-23 SMART
CA 367 449 2.99e-32 SMART
CA 473 552 9.36e-25 SMART
CA 578 659 9.9e-15 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 737 764 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 903 914 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin subfamily within the cadherin superfamily. The encoded protein is a membrane protein found at cell-cell boundaries. It is involved in neural cell adhesion, suggesting a possible role in neuronal development. The protein includes an extracelllular region, containing 7 cadherin-like domains, a transmembrane region and a C-terminal cytoplasmic region. Cells expressing the protein showed cell aggregation activity. Alternative splicing occurs in this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Pcdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdh1 APN 18 38198729 missense possibly damaging 0.65
IGL00919:Pcdh1 APN 18 38202812 nonsense probably null
IGL01744:Pcdh1 APN 18 38203249 missense probably damaging 1.00
PIT4260001:Pcdh1 UTSW 18 38203366 missense probably damaging 0.99
R0542:Pcdh1 UTSW 18 38189922 missense probably damaging 0.99
R1449:Pcdh1 UTSW 18 38189876 missense probably damaging 0.99
R1540:Pcdh1 UTSW 18 38189726 missense probably benign 0.01
R1642:Pcdh1 UTSW 18 38199230 missense possibly damaging 0.84
R1672:Pcdh1 UTSW 18 38192180 missense probably damaging 1.00
R1695:Pcdh1 UTSW 18 38202868 missense probably damaging 1.00
R1727:Pcdh1 UTSW 18 38203032 nonsense probably null
R1781:Pcdh1 UTSW 18 38189924 missense probably damaging 1.00
R1793:Pcdh1 UTSW 18 38198885 missense probably damaging 0.99
R1839:Pcdh1 UTSW 18 38199485 missense possibly damaging 0.82
R1843:Pcdh1 UTSW 18 38192225 unclassified probably null
R1882:Pcdh1 UTSW 18 38202842 missense possibly damaging 0.49
R2261:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2262:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2263:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2511:Pcdh1 UTSW 18 38199479 missense possibly damaging 0.95
R2937:Pcdh1 UTSW 18 38189762 missense probably benign 0.40
R3941:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R3942:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R4057:Pcdh1 UTSW 18 38198897 missense probably damaging 0.98
R4155:Pcdh1 UTSW 18 38203106 missense probably damaging 0.99
R4169:Pcdh1 UTSW 18 38198305 missense probably damaging 1.00
R4617:Pcdh1 UTSW 18 38197860 missense probably benign 0.00
R4690:Pcdh1 UTSW 18 38203475 missense probably benign 0.33
R4825:Pcdh1 UTSW 18 38189859 missense possibly damaging 0.77
R5201:Pcdh1 UTSW 18 38198918 missense probably damaging 0.98
R5266:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5267:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5351:Pcdh1 UTSW 18 38197766 missense probably damaging 1.00
R5568:Pcdh1 UTSW 18 38197367 missense probably damaging 1.00
R5729:Pcdh1 UTSW 18 38202946 missense probably damaging 1.00
R5731:Pcdh1 UTSW 18 38198598 missense probably damaging 1.00
R6043:Pcdh1 UTSW 18 38203274 missense probably damaging 0.97
R6278:Pcdh1 UTSW 18 38199210 missense probably benign 0.29
R6333:Pcdh1 UTSW 18 38198807 missense probably benign 0.25
R6937:Pcdh1 UTSW 18 38203475 missense possibly damaging 0.86
R6994:Pcdh1 UTSW 18 38198500 missense probably damaging 1.00
R7242:Pcdh1 UTSW 18 38203217 missense probably benign 0.06
R7289:Pcdh1 UTSW 18 38189913 missense probably damaging 0.99
R7391:Pcdh1 UTSW 18 38202785 missense possibly damaging 0.95
X0027:Pcdh1 UTSW 18 38189788 nonsense probably null
Z1088:Pcdh1 UTSW 18 38198067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGCGGGTAAGACACAC -3'
(R):5'- CAAGTTCAACCTAATGAGCGATGC -3'

Sequencing Primer
(F):5'- GGGTAAGACACACCTGCTCTATC -3'
(R):5'- TAATGAGCGATGCCCCTGGAG -3'
Posted On2018-06-06