Mutagenetix > Incidental Mutation

Incidental Mutation 'R6498:Fen1'

523123

Institutional Source

Beutler Lab

Gene Symbol

Fen1

Ensembl Gene

ENSMUSG00000024742

Gene Name

flap structure specific endonuclease 1

Synonyms

MMRRC Submission

044630-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6498 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10176496-10181533 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 10177479 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 322 (R322S)

Ref Sequence

ENSEMBL: ENSMUSP00000117246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010807] [ENSMUST00000025651] [ENSMUST00000040372] [ENSMUST00000116542] [ENSMUST00000142241] [ENSMUST00000156291]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000010807

SMART Domains

Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

Domain	Start	End	E-Value	Type
Cyt-b5	22	97	1.32e-19	SMART
transmembrane domain	134	156	N/A	INTRINSIC
Pfam:FA_desaturase	158	421	7.4e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000025651
AA Change: R322S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025651
Gene: ENSMUSG00000024742
AA Change: R322S

Domain	Start	End	E-Value	Type
XPGN	1	107	2.5e-60	SMART
XPGI	146	218	2.22e-34	SMART
HhH2	220	253	1.41e-13	SMART
low complexity region	354	380	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000040372

SMART Domains

Protein: ENSMUSP00000044751
Gene: ENSMUSG00000036372

Domain	Start	End	E-Value	Type
Pfam:UPF0197	3	79	3.3e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000081739

Predicted Effect

probably damaging
Transcript: ENSMUST00000116542
AA Change: R322S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112241
Gene: ENSMUSG00000024742
AA Change: R322S

Domain	Start	End	E-Value	Type
XPGN	1	107	2.5e-60	SMART
XPGI	146	218	2.22e-34	SMART
HhH2	220	253	1.41e-13	SMART
low complexity region	354	380	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127878

Predicted Effect

probably damaging
Transcript: ENSMUST00000142241
AA Change: R322S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000119221
Gene: ENSMUSG00000024742
AA Change: R322S

Domain	Start	End	E-Value	Type
XPGN	1	107	2.5e-60	SMART
XPGI	146	218	2.22e-34	SMART
HhH2	220	253	1.41e-13	SMART
low complexity region	354	380	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156291
AA Change: R322S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000117246
Gene: ENSMUSG00000024742
AA Change: R322S

Domain	Start	End	E-Value	Type
XPGN	1	107	2.5e-60	SMART
XPGI	146	218	2.22e-34	SMART
HhH2	220	253	1.41e-13	SMART
low complexity region	354	380	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153854

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150038

Meta Mutation Damage Score

0.2331

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 96.9%
20x: 89.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not form an inner cell mass, lack DNA synthesis in blastocyst giant cells and die by embryonic day 9.5. Embryonic day 3.5 blastocysts are hypersensitive to irradiation. Heterozygotes show enhanced adenocarcinoma susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	T	G	11: 110,182,928 (GRCm39)	N1043T	possibly damaging	Het
Actn2	C	T	13: 12,291,359 (GRCm39)	E682K	probably damaging	Het
Agtpbp1	A	G	13: 59,624,854 (GRCm39)	V833A	possibly damaging	Het
Arrb2	G	T	11: 70,330,375 (GRCm39)	R333L	probably benign	Het
Atp9b	C	T	18: 80,820,230 (GRCm39)	S135N	probably benign	Het
Cep112	T	A	11: 108,331,357 (GRCm39)	S135R	probably benign	Het
D630045J12Rik	G	A	6: 38,124,132 (GRCm39)	R1607*	probably null	Het
Duox1	A	T	2: 122,150,088 (GRCm39)	S160C	probably damaging	Het
Eogt	A	T	6: 97,112,174 (GRCm39)	Y160N	probably damaging	Het
Exosc10	T	C	4: 148,657,795 (GRCm39)	V647A	probably benign	Het
Fbxo44	C	T	4: 148,238,882 (GRCm39)			Het
Gls	A	C	1: 52,259,198 (GRCm39)	N134K	probably benign	Het
Hspg2	T	C	4: 137,235,112 (GRCm39)	V82A	possibly damaging	Het
Il33	G	A	19: 29,927,137 (GRCm39)	E23K	probably benign	Het
Macroh2a2	C	A	10: 61,593,614 (GRCm39)	V21F	probably damaging	Het
Map2k5	C	A	9: 63,193,683 (GRCm39)	A266S	possibly damaging	Het
Or13g1	T	C	7: 85,956,226 (GRCm39)	I32V	probably benign	Het
Or2t29	T	A	11: 58,433,408 (GRCm39)	N298I	probably damaging	Het
Or5p61	C	T	7: 107,758,639 (GRCm39)	C147Y	probably benign	Het
Pcdh1	G	A	18: 38,330,490 (GRCm39)	P838S	probably benign	Het
Pcdha5	A	G	18: 37,095,768 (GRCm39)	E759G	possibly damaging	Het
Pclo	T	C	5: 14,719,505 (GRCm39)	I1214T	unknown	Het
Per3	T	C	4: 151,113,662 (GRCm39)	I299V	probably benign	Het
Pls1	A	G	9: 95,636,798 (GRCm39)	I558T	probably damaging	Het
Synpo2	A	T	3: 122,873,881 (GRCm39)		probably null	Het
Sys1	G	A	2: 164,306,438 (GRCm39)	A131T	probably benign	Het
Tekt2	A	G	4: 126,218,098 (GRCm39)	L138P	probably benign	Het
Tmprss12	T	A	15: 100,183,133 (GRCm39)	N158K	probably damaging	Het
Tnrc18	A	T	5: 142,717,923 (GRCm39)	M2177K	unknown	Het
Trim43a	T	A	9: 88,464,395 (GRCm39)	I102N	probably damaging	Het
Ugt1a10	C	A	1: 88,143,862 (GRCm39)	H361N	probably damaging	Het
Utrn	C	T	10: 12,317,837 (GRCm39)	C498Y	probably benign	Het
Vmn1r39	A	T	6: 66,781,841 (GRCm39)	V159D	probably damaging	Het
Vmn1r44	A	G	6: 89,870,562 (GRCm39)	T103A	probably benign	Het
Wsb1	A	T	11: 79,139,315 (GRCm39)	V127D	probably damaging	Het
Zfp268	T	A	4: 145,349,459 (GRCm39)	C299S	probably damaging	Het

Other mutations in Fen1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02991:Fen1	UTSW	19	10,178,026 (GRCm39)	missense	probably benign
R3161:Fen1	UTSW	19	10,177,655 (GRCm39)	missense	probably damaging	0.96
R4245:Fen1	UTSW	19	10,177,731 (GRCm39)	missense	probably damaging	0.99
R5481:Fen1	UTSW	19	10,178,022 (GRCm39)	missense	probably damaging	1.00
R5553:Fen1	UTSW	19	10,177,787 (GRCm39)	missense	probably benign
R5733:Fen1	UTSW	19	10,178,022 (GRCm39)	missense	possibly damaging	0.86
R5783:Fen1	UTSW	19	10,178,194 (GRCm39)	nonsense	probably null
R6244:Fen1	UTSW	19	10,178,051 (GRCm39)	missense	probably damaging	1.00
R6797:Fen1	UTSW	19	10,178,067 (GRCm39)	missense	probably benign	0.37
R7988:Fen1	UTSW	19	10,177,674 (GRCm39)	missense	possibly damaging	0.94
R8374:Fen1	UTSW	19	10,177,824 (GRCm39)	missense	probably benign	0.26
R9016:Fen1	UTSW	19	10,178,306 (GRCm39)	missense	probably damaging	1.00
R9719:Fen1	UTSW	19	10,178,016 (GRCm39)	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GAAGGACAGGTTTATTTTCCCCTTC -3'
(R):5'- TGTGGATCTGTGCATCCTGC -3'

Sequencing Primer
(F):5'- TCGGAACTTCCCCGCTC -3'
(R):5'- AGAGCATCCGTGGCATTG -3'

Posted On

2018-06-06