Incidental Mutation 'R6498:Il33'
ID523124
Institutional Source Beutler Lab
Gene Symbol Il33
Ensembl Gene ENSMUSG00000024810
Gene Nameinterleukin 33
SynonymsNF-HEV, Il-33, Il1f11, 9230117N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29925114-29960718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29949737 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 23 (E23K)
Ref Sequence ENSEMBL: ENSMUSP00000135854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025724] [ENSMUST00000120388] [ENSMUST00000136850] [ENSMUST00000144528] [ENSMUST00000177518]
Predicted Effect probably benign
Transcript: ENSMUST00000025724
AA Change: E23K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025724
Gene: ENSMUSG00000024810
AA Change: E23K

DomainStartEndE-ValueType
Pfam:IL33 5 264 4.6e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120388
AA Change: E23K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113829
Gene: ENSMUSG00000024810
AA Change: E23K

DomainStartEndE-ValueType
Pfam:IL33 5 264 3.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136850
SMART Domains Protein: ENSMUSP00000135324
Gene: ENSMUSG00000024810

DomainStartEndE-ValueType
Pfam:IL33 7 83 1.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144528
AA Change: E23K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122319
Gene: ENSMUSG00000024810
AA Change: E23K

DomainStartEndE-ValueType
Pfam:IL33 5 66 2.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177518
AA Change: E23K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135854
Gene: ENSMUSG00000024810
AA Change: E23K

DomainStartEndE-ValueType
Pfam:IL33 5 228 4.1e-115 PFAM
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Nullizygous mutations lead to altered Type 2 immunity and increased susceptibility to parasite infection. Homozygotes for a null allele show accelerated ovarian functional decline and early reproductive aging due to impaired migration of ovarian macrophages and failed disposal of atretic follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Il33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Il33 APN 19 29952756 missense probably benign 0.00
IGL01531:Il33 APN 19 29951981 missense possibly damaging 0.71
IGL01627:Il33 APN 19 29951990 missense possibly damaging 0.95
IGL02535:Il33 APN 19 29952747 missense probably benign 0.04
lacquer UTSW 19 29951990 missense possibly damaging 0.95
PIT4504001:Il33 UTSW 19 29952739 missense probably benign 0.12
R0548:Il33 UTSW 19 29954647 missense probably benign 0.37
R0557:Il33 UTSW 19 29954636 missense probably damaging 0.98
R1511:Il33 UTSW 19 29955215 missense probably damaging 1.00
R1512:Il33 UTSW 19 29951990 missense possibly damaging 0.95
R1993:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R1994:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R2035:Il33 UTSW 19 29954637 missense probably damaging 0.98
R4779:Il33 UTSW 19 29958911 nonsense probably null
R6429:Il33 UTSW 19 29952000 missense probably benign 0.16
R6879:Il33 UTSW 19 29958962 missense probably damaging 0.98
R7218:Il33 UTSW 19 29958925 missense probably damaging 0.99
R7571:Il33 UTSW 19 29956941 missense not run
X0025:Il33 UTSW 19 29954612 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGTATGGCTATCAGTTTCATG -3'
(R):5'- AAGTGGTCAACTGTCCTATGTTG -3'

Sequencing Primer
(F):5'- TCAGTTTCATGGTGAGATAGCCAAG -3'
(R):5'- CAACGGTGATGCTGTGAAGTC -3'
Posted On2018-06-06