Incidental Mutation 'PIT4131001:Frem1'
ID523189
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #PIT4131001 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83005808 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 305 (F305L)
Ref Sequence ENSEMBL: ENSMUSP00000102849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably damaging
Transcript: ENSMUST00000071708
AA Change: F305L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: F305L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107230
AA Change: F305L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: F305L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131102
Predicted Effect probably damaging
Transcript: ENSMUST00000170248
AA Change: F306L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: F306L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,806 probably benign Het
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Alpk2 G A 18: 65,306,379 H648Y possibly damaging Het
Ambp A G 4: 63,144,265 Y246H probably damaging Het
Amz1 T C 5: 140,749,333 probably null Het
Anks6 G A 4: 47,027,109 T703I probably damaging Het
Armc2 A G 10: 41,947,887 probably benign Het
Atp7b T A 8: 21,994,656 I1347F probably damaging Het
Atp8a1 C T 5: 67,622,602 W1149* probably null Het
Auh A G 13: 52,841,010 I173T probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Axin2 T C 11: 108,924,003 L239P possibly damaging Het
Bbs1 A T 19: 4,899,259 F257L possibly damaging Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
Cacna2d2 C T 9: 107,524,668 P774L probably damaging Het
Card6 A G 15: 5,108,306 L22P probably damaging Het
Ccdc171 C T 4: 83,661,709 Het
Cdc14a T A 3: 116,328,661 N219I possibly damaging Het
Cfap65 G T 1: 74,928,342 N192K probably benign Het
Col14a1 T C 15: 55,448,876 probably benign Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Col6a5 T C 9: 105,881,914 N2031S probably damaging Het
Col7a1 T C 9: 108,965,921 probably benign Het
Ctgf T C 10: 24,596,090 V70A probably damaging Het
Cyld T C 8: 88,746,915 S739P probably damaging Het
Dbr1 A G 9: 99,584,019 probably null Het
Dip2b T C 15: 100,202,352 L1267P probably damaging Het
Dolk A G 2: 30,285,574 M153T probably benign Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Eef1d C T 15: 75,903,732 R26H probably benign Homo
Efcab5 C T 11: 77,137,691 Het
Epc1 T C 18: 6,449,246 D467G probably damaging Het
Fancm T G 12: 65,105,422 M884R probably benign Het
Fbxo24 G T 5: 137,621,902 H15N probably damaging Het
Fstl5 A G 3: 76,659,699 D550G probably damaging Het
Gcnt3 T G 9: 70,034,044 K414T possibly damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Homo
Gm10800 C A 2: 98,666,905 V123F probably benign Homo
Gm10801 A G 2: 98,662,303 R23G probably benign Homo
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21677 T C Y: 3,297,411 H235R probably benign Het
Gm21693 C T Y: 3,328,944 A241T possibly damaging Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hmgcr A G 13: 96,659,054 Y336H probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Homo
Hoxa13 G C 6: 52,260,648 probably benign Homo
Igf2bp3 A C 6: 49,117,150 probably null Het
Kcnb2 A T 1: 15,312,976 K175N possibly damaging Het
Kdr T C 5: 75,941,971 probably benign Het
Kif5c A G 2: 49,694,032 K160E probably damaging Het
Kif7 A T 7: 79,711,069 V186E probably damaging Het
Krt16 T A 11: 100,248,749 T48S unknown Het
Liph T C 16: 21,995,369 M1V probably null Het
Mctp2 A G 7: 72,090,257 F795S probably damaging Het
Muc4 C G 16: 32,755,676 probably benign Homo
Muc4 T A 16: 32,755,684 probably benign Homo
Muc4 T A 16: 32,755,699 probably benign Homo
Myo15 G T 11: 60,483,127 A1267S probably damaging Het
Myo15 T C 11: 60,495,454 Y1802H probably damaging Het
Myo7b G A 18: 31,961,206 T1963I probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Homo
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Naip5 T C 13: 100,219,760 N1116D probably benign Het
Nap1l1 A G 10: 111,486,722 D61G probably null Het
Napsa A T 7: 44,581,451 T81S probably damaging Het
Ngp T C 9: 110,422,269 probably benign Het
Nktr T A 9: 121,741,621 V143E probably damaging Het
Obscn A G 11: 59,067,064 probably null Het
Olfr1115 G A 2: 87,252,629 A231T probably benign Het
Olfr1305 G A 2: 111,873,304 L184F probably benign Het
Olfr266 T C 3: 106,821,966 I198V probably benign Het
Olfr414 A G 1: 174,430,824 Y132C probably damaging Het
Olfr597 C T 7: 103,320,869 R153* probably null Het
Olfr653 G A 7: 104,580,030 R128Q probably damaging Het
Paip2b A G 6: 83,808,841 Y136H probably damaging Het
Pde2a G T 7: 101,511,154 R845L probably damaging Het
Pgap2 A G 7: 102,237,198 Y197C possibly damaging Het
Phf11b A G 14: 59,323,162 probably benign Het
Pitpnm2 A T 5: 124,131,115 D481E probably benign Het
Pxk A T 14: 8,152,130 H482L probably benign Het
Rad50 A G 11: 53,694,899 probably null Het
Rnf220 A G 4: 117,277,369 probably null Het
Selenbp1 C T 3: 94,937,296 T88M probably damaging Het
Sft2d1 T C 17: 8,391,031 I104T possibly damaging Het
Sik1 A G 17: 31,851,331 S135P probably damaging Het
Slc16a3 T C 11: 120,955,346 F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 N85S probably benign Homo
Snrnp27 T C 6: 86,682,911 R34G unknown Het
Sos2 T C 12: 69,618,077 H393R probably benign Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Ssrp1 G A 2: 85,038,416 V40M probably damaging Het
Tada2a T C 11: 84,079,737 E202G probably damaging Het
Tcf20 C A 15: 82,851,584 A1889S probably damaging Het
Tdrd12 A T 7: 35,481,103 Y828* probably null Het
Tex45 T A 8: 3,476,062 S72T possibly damaging Het
Tlr2 T A 3: 83,838,449 D109V probably benign Het
Tomm40 G A 7: 19,703,091 T17M probably damaging Het
Tsga10ip T C 19: 5,390,133 T135A possibly damaging Het
Tspan8 G A 10: 115,817,610 V4M probably damaging Het
Ttc28 A T 5: 110,892,853 T36S probably benign Het
Ugt1a6b TTCA T 1: 88,216,158 probably benign Het
Ugt1a6b G A 1: 88,216,254 A199T probably damaging Het
Ugt1a6b G A 1: 88,218,390 R519Q probably damaging Het
Unc45a A G 7: 80,326,361 M790T possibly damaging Het
Vav3 T C 3: 109,664,435 probably null Het
Vcpkmt G A 12: 69,582,778 S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn2r66 T C 7: 84,995,093 Q703R probably damaging Het
Vmn2r98 G T 17: 19,080,961 V742F probably benign Het
Wfdc8 A G 2: 164,597,776 S229P possibly damaging Het
Xpo4 A T 14: 57,584,611 C1083S probably null Het
Zbtb38 T C 9: 96,686,316 D905G probably damaging Het
Zbtb8b A G 4: 129,427,515 *518Q probably null Het
Zfp600 TC T 4: 146,195,232 probably null Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense probably damaging 0.96
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 intron probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense not run
R7146:Frem1 UTSW 4 82922295 missense not run
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGAGATCCTTCCAGGTG -3'
(R):5'- ACATGTAGCTTGGTGGTCTC -3'

Sequencing Primer
(F):5'- CTGAGATCCTTCCAGGTGAATGAAG -3'
(R):5'- TGGTCTCAGATGGAGCGC -3'
Posted On2018-06-12