Incidental Mutation 'PIT4131001:Atp7b'
ID523217
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene NameATPase, Cu++ transporting, beta polypeptide
SynonymsAtp7a, WND, Wilson protein
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #PIT4131001 (G1)
Quality Score209.009
Status Validated
Chromosome8
Chromosomal Location21992785-22060305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21994656 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1347 (I1347F)
Ref Sequence ENSEMBL: ENSMUSP00000106366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]
Predicted Effect probably damaging
Transcript: ENSMUST00000006742
AA Change: I1462F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: I1462F

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110738
AA Change: I1347F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: I1347F

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,806 probably benign Het
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Alpk2 G A 18: 65,306,379 H648Y possibly damaging Het
Ambp A G 4: 63,144,265 Y246H probably damaging Het
Amz1 T C 5: 140,749,333 probably null Het
Anks6 G A 4: 47,027,109 T703I probably damaging Het
Armc2 A G 10: 41,947,887 probably benign Het
Atp8a1 C T 5: 67,622,602 W1149* probably null Het
Auh A G 13: 52,841,010 I173T probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Axin2 T C 11: 108,924,003 L239P possibly damaging Het
Bbs1 A T 19: 4,899,259 F257L possibly damaging Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
Cacna2d2 C T 9: 107,524,668 P774L probably damaging Het
Card6 A G 15: 5,108,306 L22P probably damaging Het
Ccdc171 C T 4: 83,661,709 Het
Cdc14a T A 3: 116,328,661 N219I possibly damaging Het
Cfap65 G T 1: 74,928,342 N192K probably benign Het
Col14a1 T C 15: 55,448,876 probably benign Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Col6a5 T C 9: 105,881,914 N2031S probably damaging Het
Col7a1 T C 9: 108,965,921 probably benign Het
Ctgf T C 10: 24,596,090 V70A probably damaging Het
Cyld T C 8: 88,746,915 S739P probably damaging Het
Dbr1 A G 9: 99,584,019 probably null Het
Dip2b T C 15: 100,202,352 L1267P probably damaging Het
Dolk A G 2: 30,285,574 M153T probably benign Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Eef1d C T 15: 75,903,732 R26H probably benign Homo
Efcab5 C T 11: 77,137,691 Het
Epc1 T C 18: 6,449,246 D467G probably damaging Het
Fancm T G 12: 65,105,422 M884R probably benign Het
Fbxo24 G T 5: 137,621,902 H15N probably damaging Het
Frem1 A G 4: 83,005,808 F305L probably damaging Het
Fstl5 A G 3: 76,659,699 D550G probably damaging Het
Gcnt3 T G 9: 70,034,044 K414T possibly damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Homo
Gm10800 C A 2: 98,666,905 V123F probably benign Homo
Gm10801 A G 2: 98,662,303 R23G probably benign Homo
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21677 T C Y: 3,297,411 H235R probably benign Het
Gm21693 C T Y: 3,328,944 A241T possibly damaging Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hmgcr A G 13: 96,659,054 Y336H probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Homo
Hoxa13 G C 6: 52,260,648 probably benign Homo
Igf2bp3 A C 6: 49,117,150 probably null Het
Kcnb2 A T 1: 15,312,976 K175N possibly damaging Het
Kdr T C 5: 75,941,971 probably benign Het
Kif5c A G 2: 49,694,032 K160E probably damaging Het
Kif7 A T 7: 79,711,069 V186E probably damaging Het
Krt16 T A 11: 100,248,749 T48S unknown Het
Liph T C 16: 21,995,369 M1V probably null Het
Mctp2 A G 7: 72,090,257 F795S probably damaging Het
Muc4 C G 16: 32,755,676 probably benign Homo
Muc4 T A 16: 32,755,684 probably benign Homo
Muc4 T A 16: 32,755,699 probably benign Homo
Myo15 G T 11: 60,483,127 A1267S probably damaging Het
Myo15 T C 11: 60,495,454 Y1802H probably damaging Het
Myo7b G A 18: 31,961,206 T1963I probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Homo
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Naip5 T C 13: 100,219,760 N1116D probably benign Het
Nap1l1 A G 10: 111,486,722 D61G probably null Het
Napsa A T 7: 44,581,451 T81S probably damaging Het
Ngp T C 9: 110,422,269 probably benign Het
Nktr T A 9: 121,741,621 V143E probably damaging Het
Obscn A G 11: 59,067,064 probably null Het
Olfr1115 G A 2: 87,252,629 A231T probably benign Het
Olfr1305 G A 2: 111,873,304 L184F probably benign Het
Olfr266 T C 3: 106,821,966 I198V probably benign Het
Olfr414 A G 1: 174,430,824 Y132C probably damaging Het
Olfr597 C T 7: 103,320,869 R153* probably null Het
Olfr653 G A 7: 104,580,030 R128Q probably damaging Het
Paip2b A G 6: 83,808,841 Y136H probably damaging Het
Pde2a G T 7: 101,511,154 R845L probably damaging Het
Pgap2 A G 7: 102,237,198 Y197C possibly damaging Het
Phf11b A G 14: 59,323,162 probably benign Het
Pitpnm2 A T 5: 124,131,115 D481E probably benign Het
Pxk A T 14: 8,152,130 H482L probably benign Het
Rad50 A G 11: 53,694,899 probably null Het
Rnf220 A G 4: 117,277,369 probably null Het
Selenbp1 C T 3: 94,937,296 T88M probably damaging Het
Sft2d1 T C 17: 8,391,031 I104T possibly damaging Het
Sik1 A G 17: 31,851,331 S135P probably damaging Het
Slc16a3 T C 11: 120,955,346 F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 N85S probably benign Homo
Snrnp27 T C 6: 86,682,911 R34G unknown Het
Sos2 T C 12: 69,618,077 H393R probably benign Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Ssrp1 G A 2: 85,038,416 V40M probably damaging Het
Tada2a T C 11: 84,079,737 E202G probably damaging Het
Tcf20 C A 15: 82,851,584 A1889S probably damaging Het
Tdrd12 A T 7: 35,481,103 Y828* probably null Het
Tex45 T A 8: 3,476,062 S72T possibly damaging Het
Tlr2 T A 3: 83,838,449 D109V probably benign Het
Tomm40 G A 7: 19,703,091 T17M probably damaging Het
Tsga10ip T C 19: 5,390,133 T135A possibly damaging Het
Tspan8 G A 10: 115,817,610 V4M probably damaging Het
Ttc28 A T 5: 110,892,853 T36S probably benign Het
Ugt1a6b TTCA T 1: 88,216,158 probably benign Het
Ugt1a6b G A 1: 88,216,254 A199T probably damaging Het
Ugt1a6b G A 1: 88,218,390 R519Q probably damaging Het
Unc45a A G 7: 80,326,361 M790T possibly damaging Het
Vav3 T C 3: 109,664,435 probably null Het
Vcpkmt G A 12: 69,582,778 S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn2r66 T C 7: 84,995,093 Q703R probably damaging Het
Vmn2r98 G T 17: 19,080,961 V742F probably benign Het
Wfdc8 A G 2: 164,597,776 S229P possibly damaging Het
Xpo4 A T 14: 57,584,611 C1083S probably null Het
Zbtb38 T C 9: 96,686,316 D905G probably damaging Het
Zbtb8b A G 4: 129,427,515 *518Q probably null Het
Zfp600 TC T 4: 146,195,232 probably null Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22011098 missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22027527 splice site probably null
IGL01600:Atp7b APN 8 22027525 splice site probably null
IGL01713:Atp7b APN 8 22028573 missense probably damaging 1.00
IGL01778:Atp7b APN 8 21994828 missense probably benign 0.42
IGL01926:Atp7b APN 8 22011781 missense probably damaging 0.98
IGL02312:Atp7b APN 8 21994770 missense probably damaging 0.99
IGL02562:Atp7b APN 8 22028085 missense probably benign
IGL02573:Atp7b APN 8 22022470 missense probably benign 0.00
IGL02603:Atp7b APN 8 21994776 missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22028438 missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22022477 missense probably benign 0.00
IGL03145:Atp7b APN 8 22018143 missense probably damaging 1.00
daffodil UTSW 8 21998266 missense probably damaging 1.00
R0023:Atp7b UTSW 8 22011073 missense probably damaging 1.00
R0046:Atp7b UTSW 8 22059995 missense probably benign 0.00
R0128:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22028451 missense probably benign 0.22
R0412:Atp7b UTSW 8 21995659 splice site probably null
R0856:Atp7b UTSW 8 21997631 missense probably damaging 1.00
R0906:Atp7b UTSW 8 22027826 missense probably benign
R0989:Atp7b UTSW 8 22028694 missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22011785 missense probably benign 0.17
R1517:Atp7b UTSW 8 21997358 missense probably damaging 1.00
R1521:Atp7b UTSW 8 22027673 missense probably damaging 0.96
R1529:Atp7b UTSW 8 22028724 missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22006387 missense probably damaging 1.00
R1815:Atp7b UTSW 8 22011651 missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22027980 missense probably damaging 1.00
R2133:Atp7b UTSW 8 22011077 missense probably damaging 1.00
R2155:Atp7b UTSW 8 22013584 missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22014547 missense probably damaging 0.99
R2256:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2257:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2274:Atp7b UTSW 8 22020832 missense probably benign 0.20
R2475:Atp7b UTSW 8 21994776 missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R2907:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R3421:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3422:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3688:Atp7b UTSW 8 22004230 missense probably damaging 1.00
R3945:Atp7b UTSW 8 22020864 missense probably benign 0.02
R4235:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4701:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4877:Atp7b UTSW 8 22028601 missense probably damaging 0.98
R4962:Atp7b UTSW 8 22020885 missense probably damaging 1.00
R5009:Atp7b UTSW 8 22027698 missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22015869 splice site probably null
R5038:Atp7b UTSW 8 22028456 missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22014554 missense probably benign
R5467:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R5468:Atp7b UTSW 8 22059970 critical splice donor site probably null
R5512:Atp7b UTSW 8 22012739 missense probably benign 0.20
R5563:Atp7b UTSW 8 22028714 missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22018128 missense probably damaging 1.00
R5773:Atp7b UTSW 8 22027863 missense probably benign
R5941:Atp7b UTSW 8 21997496 missense probably damaging 0.98
R6227:Atp7b UTSW 8 22020825 missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22015927 nonsense probably null
R6290:Atp7b UTSW 8 22020820 missense probably damaging 1.00
R6368:Atp7b UTSW 8 22020755 splice site probably null
R6647:Atp7b UTSW 8 22028478 missense probably damaging 1.00
R6788:Atp7b UTSW 8 22004375 missense probably benign 0.37
R6830:Atp7b UTSW 8 22022365 missense probably damaging 0.97
R6886:Atp7b UTSW 8 22028690 missense probably benign 0.01
R6928:Atp7b UTSW 8 21994812 missense probably benign
R6965:Atp7b UTSW 8 22028085 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCTGGAAGAGCAATCCTGC -3'
(R):5'- AAGTCAGCGTGCACATTGG -3'

Sequencing Primer
(F):5'- TGCCCAGCCTCTGCAGATAC -3'
(R):5'- TGCACATTGGCATGGATGACC -3'
Posted On2018-06-12