Incidental Mutation 'PIT4131001:Myo15'
ID523242
Institutional Source Beutler Lab
Gene Symbol Myo15
Ensembl Gene ENSMUSG00000042678
Gene Namemyosin XV
Synonymssh2; sh-2; Myo15a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4131001 (G1)
Quality Score197.009
Status Validated
Chromosome11
Chromosomal Location60469339-60528369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60495454 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1802 (Y1802H)
Ref Sequence ENSEMBL: ENSMUSP00000091686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
Predicted Effect probably damaging
Transcript: ENSMUST00000071880
AA Change: Y1802H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: Y1802H

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081823
AA Change: Y615H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: Y615H

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094135
AA Change: Y1802H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: Y1802H

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126522
AA Change: Y633H
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: Y633H

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,806 probably benign Het
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Alpk2 G A 18: 65,306,379 H648Y possibly damaging Het
Ambp A G 4: 63,144,265 Y246H probably damaging Het
Amz1 T C 5: 140,749,333 probably null Het
Anks6 G A 4: 47,027,109 T703I probably damaging Het
Armc2 A G 10: 41,947,887 probably benign Het
Atp7b T A 8: 21,994,656 I1347F probably damaging Het
Atp8a1 C T 5: 67,622,602 W1149* probably null Het
Auh A G 13: 52,841,010 I173T probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Axin2 T C 11: 108,924,003 L239P possibly damaging Het
Bbs1 A T 19: 4,899,259 F257L possibly damaging Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
Cacna2d2 C T 9: 107,524,668 P774L probably damaging Het
Card6 A G 15: 5,108,306 L22P probably damaging Het
Ccdc171 C T 4: 83,661,709 Het
Cdc14a T A 3: 116,328,661 N219I possibly damaging Het
Cfap65 G T 1: 74,928,342 N192K probably benign Het
Col14a1 T C 15: 55,448,876 probably benign Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Col6a5 T C 9: 105,881,914 N2031S probably damaging Het
Col7a1 T C 9: 108,965,921 probably benign Het
Ctgf T C 10: 24,596,090 V70A probably damaging Het
Cyld T C 8: 88,746,915 S739P probably damaging Het
Dbr1 A G 9: 99,584,019 probably null Het
Dip2b T C 15: 100,202,352 L1267P probably damaging Het
Dolk A G 2: 30,285,574 M153T probably benign Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Eef1d C T 15: 75,903,732 R26H probably benign Homo
Efcab5 C T 11: 77,137,691 Het
Epc1 T C 18: 6,449,246 D467G probably damaging Het
Fancm T G 12: 65,105,422 M884R probably benign Het
Fbxo24 G T 5: 137,621,902 H15N probably damaging Het
Frem1 A G 4: 83,005,808 F305L probably damaging Het
Fstl5 A G 3: 76,659,699 D550G probably damaging Het
Gcnt3 T G 9: 70,034,044 K414T possibly damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Homo
Gm10800 C A 2: 98,666,905 V123F probably benign Homo
Gm10801 A G 2: 98,662,303 R23G probably benign Homo
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21677 T C Y: 3,297,411 H235R probably benign Het
Gm21693 C T Y: 3,328,944 A241T possibly damaging Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hmgcr A G 13: 96,659,054 Y336H probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Homo
Hoxa13 G C 6: 52,260,648 probably benign Homo
Igf2bp3 A C 6: 49,117,150 probably null Het
Kcnb2 A T 1: 15,312,976 K175N possibly damaging Het
Kdr T C 5: 75,941,971 probably benign Het
Kif5c A G 2: 49,694,032 K160E probably damaging Het
Kif7 A T 7: 79,711,069 V186E probably damaging Het
Krt16 T A 11: 100,248,749 T48S unknown Het
Liph T C 16: 21,995,369 M1V probably null Het
Mctp2 A G 7: 72,090,257 F795S probably damaging Het
Muc4 C G 16: 32,755,676 probably benign Homo
Muc4 T A 16: 32,755,684 probably benign Homo
Muc4 T A 16: 32,755,699 probably benign Homo
Myo7b G A 18: 31,961,206 T1963I probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Homo
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Naip5 T C 13: 100,219,760 N1116D probably benign Het
Nap1l1 A G 10: 111,486,722 D61G probably null Het
Napsa A T 7: 44,581,451 T81S probably damaging Het
Ngp T C 9: 110,422,269 probably benign Het
Nktr T A 9: 121,741,621 V143E probably damaging Het
Obscn A G 11: 59,067,064 probably null Het
Olfr1115 G A 2: 87,252,629 A231T probably benign Het
Olfr1305 G A 2: 111,873,304 L184F probably benign Het
Olfr266 T C 3: 106,821,966 I198V probably benign Het
Olfr414 A G 1: 174,430,824 Y132C probably damaging Het
Olfr597 C T 7: 103,320,869 R153* probably null Het
Olfr653 G A 7: 104,580,030 R128Q probably damaging Het
Paip2b A G 6: 83,808,841 Y136H probably damaging Het
Pde2a G T 7: 101,511,154 R845L probably damaging Het
Pgap2 A G 7: 102,237,198 Y197C possibly damaging Het
Phf11b A G 14: 59,323,162 probably benign Het
Pitpnm2 A T 5: 124,131,115 D481E probably benign Het
Pxk A T 14: 8,152,130 H482L probably benign Het
Rad50 A G 11: 53,694,899 probably null Het
Rnf220 A G 4: 117,277,369 probably null Het
Selenbp1 C T 3: 94,937,296 T88M probably damaging Het
Sft2d1 T C 17: 8,391,031 I104T possibly damaging Het
Sik1 A G 17: 31,851,331 S135P probably damaging Het
Slc16a3 T C 11: 120,955,346 F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 N85S probably benign Homo
Snrnp27 T C 6: 86,682,911 R34G unknown Het
Sos2 T C 12: 69,618,077 H393R probably benign Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Ssrp1 G A 2: 85,038,416 V40M probably damaging Het
Tada2a T C 11: 84,079,737 E202G probably damaging Het
Tcf20 C A 15: 82,851,584 A1889S probably damaging Het
Tdrd12 A T 7: 35,481,103 Y828* probably null Het
Tex45 T A 8: 3,476,062 S72T possibly damaging Het
Tlr2 T A 3: 83,838,449 D109V probably benign Het
Tomm40 G A 7: 19,703,091 T17M probably damaging Het
Tsga10ip T C 19: 5,390,133 T135A possibly damaging Het
Tspan8 G A 10: 115,817,610 V4M probably damaging Het
Ttc28 A T 5: 110,892,853 T36S probably benign Het
Ugt1a6b TTCA T 1: 88,216,158 probably benign Het
Ugt1a6b G A 1: 88,216,254 A199T probably damaging Het
Ugt1a6b G A 1: 88,218,390 R519Q probably damaging Het
Unc45a A G 7: 80,326,361 M790T possibly damaging Het
Vav3 T C 3: 109,664,435 probably null Het
Vcpkmt G A 12: 69,582,778 S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn2r66 T C 7: 84,995,093 Q703R probably damaging Het
Vmn2r98 G T 17: 19,080,961 V742F probably benign Het
Wfdc8 A G 2: 164,597,776 S229P possibly damaging Het
Xpo4 A T 14: 57,584,611 C1083S probably null Het
Zbtb38 T C 9: 96,686,316 D905G probably damaging Het
Zbtb8b A G 4: 129,427,515 *518Q probably null Het
Zfp600 TC T 4: 146,195,232 probably null Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Myo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60477779 missense probably damaging 1.00
IGL01011:Myo15 APN 11 60476992 missense probably benign 0.33
IGL01100:Myo15 APN 11 60511158 missense probably damaging 1.00
IGL01357:Myo15 APN 11 60502289 splice site probably benign
IGL01634:Myo15 APN 11 60495472 missense probably damaging 1.00
IGL01763:Myo15 APN 11 60521738 missense probably benign 0.07
IGL01901:Myo15 APN 11 60527434 utr 3 prime probably benign
IGL01931:Myo15 APN 11 60496138 missense probably damaging 1.00
IGL02006:Myo15 APN 11 60511128 missense probably damaging 1.00
IGL02041:Myo15 APN 11 60506863 missense probably damaging 0.99
IGL02094:Myo15 APN 11 60510647 unclassified probably benign
IGL02122:Myo15 APN 11 60483466 missense probably benign 0.23
IGL02153:Myo15 APN 11 60498397 missense probably damaging 1.00
IGL02328:Myo15 APN 11 60526607 missense probably benign 0.13
IGL02330:Myo15 APN 11 60477161 missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60510639 missense possibly damaging 0.73
IGL02639:Myo15 APN 11 60478621 missense probably benign
IGL02659:Myo15 APN 11 60491783 splice site probably benign
IGL02800:Myo15 APN 11 60502369 missense probably damaging 1.00
IGL02812:Myo15 APN 11 60477179 missense probably benign 0.15
IGL02863:Myo15 APN 11 60478127 missense probably damaging 1.00
IGL02873:Myo15 APN 11 60483482 missense probably damaging 1.00
IGL02990:Myo15 APN 11 60479440 missense probably benign 0.02
IGL03011:Myo15 APN 11 60509531 splice site probably benign
IGL03243:Myo15 APN 11 60496518 missense probably damaging 1.00
IGL03297:Myo15 APN 11 60479141 missense probably damaging 1.00
parker UTSW 11 60520914 critical splice donor site probably null
typhoon UTSW 11 60487425 critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60483127 missense probably damaging 1.00
R0133:Myo15 UTSW 11 60477850 missense possibly damaging 0.94
R0265:Myo15 UTSW 11 60514897 critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60478538 missense probably benign
R0416:Myo15 UTSW 11 60511174 missense probably damaging 1.00
R0449:Myo15 UTSW 11 60509596 missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60520914 critical splice donor site probably null
R0543:Myo15 UTSW 11 60479051 missense probably benign
R0546:Myo15 UTSW 11 60506313 missense probably damaging 1.00
R0555:Myo15 UTSW 11 60521638 missense probably damaging 1.00
R0639:Myo15 UTSW 11 60479336 missense probably benign 0.12
R0723:Myo15 UTSW 11 60478977 missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60487251 missense probably damaging 0.98
R0865:Myo15 UTSW 11 60491688 missense probably damaging 1.00
R0899:Myo15 UTSW 11 60477185 missense possibly damaging 0.87
R1022:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1024:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1035:Myo15 UTSW 11 60510558 unclassified probably benign
R1109:Myo15 UTSW 11 60493066 missense probably damaging 1.00
R1170:Myo15 UTSW 11 60479407 missense probably benign 0.04
R1241:Myo15 UTSW 11 60499430 missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60504331 missense probably benign 0.00
R1450:Myo15 UTSW 11 60495482 missense probably damaging 1.00
R1456:Myo15 UTSW 11 60508202 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1548:Myo15 UTSW 11 60488238 missense probably damaging 1.00
R1551:Myo15 UTSW 11 60492965 missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60518464 missense probably damaging 1.00
R1662:Myo15 UTSW 11 60501701 missense probably damaging 1.00
R1777:Myo15 UTSW 11 60514936 missense probably benign
R1778:Myo15 UTSW 11 60478412 missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60499495 nonsense probably null
R1875:Myo15 UTSW 11 60507528 missense probably damaging 0.99
R1944:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R1945:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R2013:Myo15 UTSW 11 60494231 missense probably damaging 1.00
R2107:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2108:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2112:Myo15 UTSW 11 60494168 missense probably damaging 0.99
R2147:Myo15 UTSW 11 60510229 missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60510021 nonsense probably null
R2207:Myo15 UTSW 11 60506034 missense probably benign 0.01
R2245:Myo15 UTSW 11 60509099 missense probably damaging 1.00
R2367:Myo15 UTSW 11 60517238 missense probably damaging 0.99
R2374:Myo15 UTSW 11 60478843 missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60483052 missense probably damaging 1.00
R3154:Myo15 UTSW 11 60479360 unclassified probably null
R3423:Myo15 UTSW 11 60510300 critical splice donor site probably null
R3551:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60477679 missense probably damaging 1.00
R3620:Myo15 UTSW 11 60478642 missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3784:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3785:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3786:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3787:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3894:Myo15 UTSW 11 60504319 missense probably benign 0.00
R3962:Myo15 UTSW 11 60479828 missense probably benign 0.00
R4082:Myo15 UTSW 11 60487196 missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60496937 missense probably damaging 1.00
R4641:Myo15 UTSW 11 60503041 missense probably damaging 1.00
R4665:Myo15 UTSW 11 60504879 critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60479930 missense probably benign 0.21
R4820:Myo15 UTSW 11 60476915 missense probably damaging 0.98
R5013:Myo15 UTSW 11 60491667 missense probably damaging 1.00
R5051:Myo15 UTSW 11 60487425 critical splice donor site probably null
R5187:Myo15 UTSW 11 60503614 missense probably damaging 1.00
R5230:Myo15 UTSW 11 60502848 missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60477114 nonsense probably null
R5345:Myo15 UTSW 11 60497538 missense probably damaging 0.99
R5349:Myo15 UTSW 11 60493583 missense probably damaging 1.00
R5356:Myo15 UTSW 11 60498366 missense probably damaging 1.00
R5445:Myo15 UTSW 11 60520777 nonsense probably null
R5477:Myo15 UTSW 11 60477677 missense probably damaging 1.00
R5629:Myo15 UTSW 11 60479752 missense probably benign
R5728:Myo15 UTSW 11 60488896 missense probably damaging 1.00
R5818:Myo15 UTSW 11 60497951 missense probably benign 0.06
R5952:Myo15 UTSW 11 60479420 missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60478133 missense probably damaging 0.99
R6467:Myo15 UTSW 11 60526661 critical splice donor site probably null
R6488:Myo15 UTSW 11 60478487 missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60502369 missense probably damaging 1.00
R6645:Myo15 UTSW 11 60477292 missense probably benign 0.00
R6702:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6703:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6821:Myo15 UTSW 11 60524475 missense probably damaging 1.00
R6882:Myo15 UTSW 11 60524006 missense probably damaging 1.00
R6908:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R6932:Myo15 UTSW 11 60499494 missense probably damaging 1.00
R6958:Myo15 UTSW 11 60503625 missense probably benign 0.07
X0021:Myo15 UTSW 11 60482359 nonsense probably null
X0066:Myo15 UTSW 11 60478220 missense probably damaging 1.00
X0067:Myo15 UTSW 11 60478618 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATAAGAAGGTGAGGCCCCTG -3'
(R):5'- GTGCAGCTTAAACAACAGTGAAC -3'

Sequencing Primer
(F):5'- AAATCCTTCCCCCTGTGAAGTGTG -3'
(R):5'- GTGAACAACTGACCCTATGTTGC -3'
Posted On2018-06-12