Incidental Mutation 'PIT4131001:Col14a1'
ID523260
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4131001 (G1)
Quality Score50
Status Validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 55448876 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect probably benign
Transcript: ENSMUST00000023053
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110217
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110221
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125416
SMART Domains Protein: ENSMUSP00000122455
Gene: ENSMUSG00000022371

DomainStartEndE-ValueType
TSPN 2 165 2.04e-42 SMART
Pfam:Collagen 201 255 2.1e-9 PFAM
Pfam:Collagen 253 305 3.3e-9 PFAM
Pfam:Collagen 295 355 4.4e-11 PFAM
Pfam:Collagen 393 448 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,806 probably benign Het
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Alpk2 G A 18: 65,306,379 H648Y possibly damaging Het
Ambp A G 4: 63,144,265 Y246H probably damaging Het
Amz1 T C 5: 140,749,333 probably null Het
Anks6 G A 4: 47,027,109 T703I probably damaging Het
Armc2 A G 10: 41,947,887 probably benign Het
Atp7b T A 8: 21,994,656 I1347F probably damaging Het
Atp8a1 C T 5: 67,622,602 W1149* probably null Het
Auh A G 13: 52,841,010 I173T probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Axin2 T C 11: 108,924,003 L239P possibly damaging Het
Bbs1 A T 19: 4,899,259 F257L possibly damaging Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
Cacna2d2 C T 9: 107,524,668 P774L probably damaging Het
Card6 A G 15: 5,108,306 L22P probably damaging Het
Ccdc171 C T 4: 83,661,709 Het
Cdc14a T A 3: 116,328,661 N219I possibly damaging Het
Cfap65 G T 1: 74,928,342 N192K probably benign Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Col6a5 T C 9: 105,881,914 N2031S probably damaging Het
Col7a1 T C 9: 108,965,921 probably benign Het
Ctgf T C 10: 24,596,090 V70A probably damaging Het
Cyld T C 8: 88,746,915 S739P probably damaging Het
Dbr1 A G 9: 99,584,019 probably null Het
Dip2b T C 15: 100,202,352 L1267P probably damaging Het
Dolk A G 2: 30,285,574 M153T probably benign Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Eef1d C T 15: 75,903,732 R26H probably benign Homo
Efcab5 C T 11: 77,137,691 Het
Epc1 T C 18: 6,449,246 D467G probably damaging Het
Fancm T G 12: 65,105,422 M884R probably benign Het
Fbxo24 G T 5: 137,621,902 H15N probably damaging Het
Frem1 A G 4: 83,005,808 F305L probably damaging Het
Fstl5 A G 3: 76,659,699 D550G probably damaging Het
Gcnt3 T G 9: 70,034,044 K414T possibly damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Homo
Gm10800 C A 2: 98,666,905 V123F probably benign Homo
Gm10801 A G 2: 98,662,303 R23G probably benign Homo
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21677 T C Y: 3,297,411 H235R probably benign Het
Gm21693 C T Y: 3,328,944 A241T possibly damaging Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hmgcr A G 13: 96,659,054 Y336H probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Homo
Hoxa13 G C 6: 52,260,648 probably benign Homo
Igf2bp3 A C 6: 49,117,150 probably null Het
Kcnb2 A T 1: 15,312,976 K175N possibly damaging Het
Kdr T C 5: 75,941,971 probably benign Het
Kif5c A G 2: 49,694,032 K160E probably damaging Het
Kif7 A T 7: 79,711,069 V186E probably damaging Het
Krt16 T A 11: 100,248,749 T48S unknown Het
Liph T C 16: 21,995,369 M1V probably null Het
Mctp2 A G 7: 72,090,257 F795S probably damaging Het
Muc4 C G 16: 32,755,676 probably benign Homo
Muc4 T A 16: 32,755,684 probably benign Homo
Muc4 T A 16: 32,755,699 probably benign Homo
Myo15 G T 11: 60,483,127 A1267S probably damaging Het
Myo15 T C 11: 60,495,454 Y1802H probably damaging Het
Myo7b G A 18: 31,961,206 T1963I probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Homo
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Naip5 T C 13: 100,219,760 N1116D probably benign Het
Nap1l1 A G 10: 111,486,722 D61G probably null Het
Napsa A T 7: 44,581,451 T81S probably damaging Het
Ngp T C 9: 110,422,269 probably benign Het
Nktr T A 9: 121,741,621 V143E probably damaging Het
Obscn A G 11: 59,067,064 probably null Het
Olfr1115 G A 2: 87,252,629 A231T probably benign Het
Olfr1305 G A 2: 111,873,304 L184F probably benign Het
Olfr266 T C 3: 106,821,966 I198V probably benign Het
Olfr414 A G 1: 174,430,824 Y132C probably damaging Het
Olfr597 C T 7: 103,320,869 R153* probably null Het
Olfr653 G A 7: 104,580,030 R128Q probably damaging Het
Paip2b A G 6: 83,808,841 Y136H probably damaging Het
Pde2a G T 7: 101,511,154 R845L probably damaging Het
Pgap2 A G 7: 102,237,198 Y197C possibly damaging Het
Phf11b A G 14: 59,323,162 probably benign Het
Pitpnm2 A T 5: 124,131,115 D481E probably benign Het
Pxk A T 14: 8,152,130 H482L probably benign Het
Rad50 A G 11: 53,694,899 probably null Het
Rnf220 A G 4: 117,277,369 probably null Het
Selenbp1 C T 3: 94,937,296 T88M probably damaging Het
Sft2d1 T C 17: 8,391,031 I104T possibly damaging Het
Sik1 A G 17: 31,851,331 S135P probably damaging Het
Slc16a3 T C 11: 120,955,346 F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 N85S probably benign Homo
Snrnp27 T C 6: 86,682,911 R34G unknown Het
Sos2 T C 12: 69,618,077 H393R probably benign Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Ssrp1 G A 2: 85,038,416 V40M probably damaging Het
Tada2a T C 11: 84,079,737 E202G probably damaging Het
Tcf20 C A 15: 82,851,584 A1889S probably damaging Het
Tdrd12 A T 7: 35,481,103 Y828* probably null Het
Tex45 T A 8: 3,476,062 S72T possibly damaging Het
Tlr2 T A 3: 83,838,449 D109V probably benign Het
Tomm40 G A 7: 19,703,091 T17M probably damaging Het
Tsga10ip T C 19: 5,390,133 T135A possibly damaging Het
Tspan8 G A 10: 115,817,610 V4M probably damaging Het
Ttc28 A T 5: 110,892,853 T36S probably benign Het
Ugt1a6b TTCA T 1: 88,216,158 probably benign Het
Ugt1a6b G A 1: 88,216,254 A199T probably damaging Het
Ugt1a6b G A 1: 88,218,390 R519Q probably damaging Het
Unc45a A G 7: 80,326,361 M790T possibly damaging Het
Vav3 T C 3: 109,664,435 probably null Het
Vcpkmt G A 12: 69,582,778 S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn2r66 T C 7: 84,995,093 Q703R probably damaging Het
Vmn2r98 G T 17: 19,080,961 V742F probably benign Het
Wfdc8 A G 2: 164,597,776 S229P possibly damaging Het
Xpo4 A T 14: 57,584,611 C1083S probably null Het
Zbtb38 T C 9: 96,686,316 D905G probably damaging Het
Zbtb8b A G 4: 129,427,515 *518Q probably null Het
Zfp600 TC T 4: 146,195,232 probably null Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers
Posted On2018-06-12