Incidental Mutation 'R6574:Ackr3'
ID523335
Institutional Source Beutler Lab
Gene Symbol Ackr3
Ensembl Gene ENSMUSG00000044337
Gene Nameatypical chemokine receptor 3
SynonymsCxcr7, Cmkor1, Rdc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location90203980-90216751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90214068 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 83 (I83T)
Ref Sequence ENSEMBL: ENSMUSP00000069114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065587] [ENSMUST00000159654]
Predicted Effect probably damaging
Transcript: ENSMUST00000065587
AA Change: I83T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069114
Gene: ENSMUSG00000044337
AA Change: I83T

DomainStartEndE-ValueType
Pfam:7tm_1 61 315 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159654
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor family. Although this protein was earlier thought to be a receptor for vasoactive intestinal peptide (VIP), it is now considered to be an orphan receptor, in that its endogenous ligand has not been identified. The protein is also a coreceptor for human immunodeficiency viruses (HIV). Translocations involving this gene and HMGA2 on chromosome 12 have been observed in lipomas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mutations result in perinatal lethality with cardiac defects including semilunar valve defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Ackr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ackr3 APN 1 90214134 missense probably benign 0.03
P0042:Ackr3 UTSW 1 90214878 missense probably damaging 1.00
R0616:Ackr3 UTSW 1 90214469 missense probably benign 0.00
R1792:Ackr3 UTSW 1 90214898 missense probably benign 0.08
R2074:Ackr3 UTSW 1 90213981 missense probably damaging 1.00
R2152:Ackr3 UTSW 1 90213843 missense probably benign 0.00
R3839:Ackr3 UTSW 1 90214128 missense probably damaging 1.00
R4683:Ackr3 UTSW 1 90213987 missense probably damaging 0.96
R5569:Ackr3 UTSW 1 90214841 missense probably benign 0.30
R7324:Ackr3 UTSW 1 90214201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACTCTGACATCAACTGGCC -3'
(R):5'- TGATGGAGAGATAGCGGTCC -3'

Sequencing Primer
(F):5'- TGGCCATGTAACAGCAGC -3'
(R):5'- TCCACGCTCATGCAGGC -3'
Posted On2018-06-22