Incidental Mutation 'R6574:Ptbp2'
ID523342
Institutional Source Beutler Lab
Gene Symbol Ptbp2
Ensembl Gene ENSMUSG00000028134
Gene Namepolypyrimidine tract binding protein 2
SynonymsbrPTB
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location119718742-119784466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119747947 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 147 (Q147P)
Ref Sequence ENSEMBL: ENSMUSP00000143281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029780] [ENSMUST00000197464] [ENSMUST00000197833] [ENSMUST00000200097]
Predicted Effect probably benign
Transcript: ENSMUST00000029780
AA Change: Q147P

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029780
Gene: ENSMUSG00000028134
AA Change: Q147P

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 526 1.99e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197464
AA Change: Q147P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143281
Gene: ENSMUSG00000028134
AA Change: Q147P

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
Pfam:RRM_1 183 239 8.6e-6 PFAM
Pfam:RRM_5 197 240 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197833
AA Change: Q147P

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143719
Gene: ENSMUSG00000028134
AA Change: Q147P

DomainStartEndE-ValueType
RRM 60 129 1.7e-8 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 5.2e-7 SMART
low complexity region 285 295 N/A INTRINSIC
PDB:2MJU|A 325 349 4e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199417
Predicted Effect probably benign
Transcript: ENSMUST00000200097
AA Change: Q147P

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143510
Gene: ENSMUSG00000028134
AA Change: Q147P

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 525 8.08e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to intronic polypyrimidine clusters in pre-mRNA molecules and is implicated in controlling the assembly of other splicing-regulatory proteins. This protein is very similar to the polypyrimidine tract binding protein (PTB) but most of its isoforms are expressed primarily in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality with premature neurogenesis and abnormal neural stem cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Ptbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ptbp2 APN 3 119747812 missense probably damaging 1.00
IGL01874:Ptbp2 APN 3 119747800 missense probably damaging 1.00
IGL01940:Ptbp2 APN 3 119726115 missense possibly damaging 0.46
IGL02094:Ptbp2 APN 3 119752940 splice site probably benign
IGL02374:Ptbp2 APN 3 119720693 splice site probably benign
IGL02523:Ptbp2 APN 3 119740487 nonsense probably null
IGL02879:Ptbp2 APN 3 119740405 missense probably damaging 1.00
IGL03149:Ptbp2 APN 3 119720425 missense possibly damaging 0.86
IGL03153:Ptbp2 APN 3 119751944 missense probably benign 0.04
IGL03391:Ptbp2 APN 3 119720382 nonsense probably null
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0091:Ptbp2 UTSW 3 119720661 missense probably damaging 1.00
R0396:Ptbp2 UTSW 3 119724198 splice site probably benign
R0511:Ptbp2 UTSW 3 119720964 missense probably benign
R0722:Ptbp2 UTSW 3 119720921 missense possibly damaging 0.72
R1573:Ptbp2 UTSW 3 119753105 missense probably damaging 1.00
R1907:Ptbp2 UTSW 3 119761749 missense probably damaging 1.00
R3606:Ptbp2 UTSW 3 119747632 missense probably damaging 1.00
R5082:Ptbp2 UTSW 3 119752964 missense probably benign 0.06
R5575:Ptbp2 UTSW 3 119720783 splice site probably null
R5575:Ptbp2 UTSW 3 119720789 missense possibly damaging 0.86
R5655:Ptbp2 UTSW 3 119724157 missense probably benign 0.44
R5836:Ptbp2 UTSW 3 119726097 missense probably damaging 0.98
R6290:Ptbp2 UTSW 3 119724120 missense possibly damaging 0.50
R6364:Ptbp2 UTSW 3 119740442 missense probably damaging 1.00
R6398:Ptbp2 UTSW 3 119720835 missense probably benign 0.23
R7037:Ptbp2 UTSW 3 119751908 missense probably damaging 1.00
R7243:Ptbp2 UTSW 3 119753112 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCAAATGACACTTACTTGGTGAAG -3'
(R):5'- AGTCCATTTCCTGTAGTGTGCC -3'

Sequencing Primer
(F):5'- GACACTTACTTGGTGAAGGACATC -3'
(R):5'- GCCTGTTTCATAGAGGGGATAATG -3'
Posted On2018-06-22