Incidental Mutation 'R6574:Ppp2r3a'
Institutional Source Beutler Lab
Gene Symbol Ppp2r3a
Ensembl Gene ENSMUSG00000043154
Gene Nameprotein phosphatase 2, regulatory subunit B'', alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location101105084-101251795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101194385 bp
Amino Acid Change Proline to Leucine at position 678 (P678L)
Ref Sequence ENSEMBL: ENSMUSP00000075327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941]
Predicted Effect probably benign
Transcript: ENSMUST00000066773
AA Change: P58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154
AA Change: P58L

Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075941
AA Change: P678L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154
AA Change: P678L

low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193545
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Ppp2r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ppp2r3a APN 9 101211301 missense possibly damaging 0.50
IGL01122:Ppp2r3a APN 9 101211645 missense probably benign 0.30
IGL02332:Ppp2r3a APN 9 101180403 missense possibly damaging 0.78
IGL02653:Ppp2r3a APN 9 101211693 missense probably benign 0.13
IGL03329:Ppp2r3a APN 9 101126431 splice site probably benign
IGL03351:Ppp2r3a APN 9 101211192 missense probably benign 0.00
lank UTSW 9 101198630 critical splice donor site probably null
PIT4480001:Ppp2r3a UTSW 9 101126377 missense possibly damaging 0.95
PIT4687001:Ppp2r3a UTSW 9 101144380 missense probably benign 0.00
R0243:Ppp2r3a UTSW 9 101212284 missense probably damaging 1.00
R1004:Ppp2r3a UTSW 9 101198630 critical splice donor site probably null
R1086:Ppp2r3a UTSW 9 101153822 missense possibly damaging 0.67
R1215:Ppp2r3a UTSW 9 101212684 missense probably benign 0.02
R1245:Ppp2r3a UTSW 9 101194394 missense probably damaging 0.99
R1458:Ppp2r3a UTSW 9 101211312 missense probably damaging 1.00
R1682:Ppp2r3a UTSW 9 101212306 missense probably benign 0.00
R1857:Ppp2r3a UTSW 9 101212893 missense probably damaging 0.96
R1972:Ppp2r3a UTSW 9 101211777 missense probably benign 0.00
R2029:Ppp2r3a UTSW 9 101145481 missense probably damaging 1.00
R2076:Ppp2r3a UTSW 9 101144371 missense possibly damaging 0.83
R2135:Ppp2r3a UTSW 9 101211558 missense probably damaging 0.99
R2180:Ppp2r3a UTSW 9 101127015 nonsense probably null
R3155:Ppp2r3a UTSW 9 101212360 missense possibly damaging 0.56
R4797:Ppp2r3a UTSW 9 101211980 missense probably benign 0.01
R4829:Ppp2r3a UTSW 9 101212510 missense possibly damaging 0.67
R5269:Ppp2r3a UTSW 9 101153865 missense probably damaging 0.98
R5917:Ppp2r3a UTSW 9 101211984 missense probably benign 0.10
R5939:Ppp2r3a UTSW 9 101212625 missense probably benign 0.37
R6089:Ppp2r3a UTSW 9 101211636 missense probably benign 0.00
R6254:Ppp2r3a UTSW 9 101148587 missense possibly damaging 0.75
R6776:Ppp2r3a UTSW 9 101212862 missense probably benign 0.00
R6927:Ppp2r3a UTSW 9 101175348 missense probably damaging 1.00
R7189:Ppp2r3a UTSW 9 101126422 missense possibly damaging 0.59
R7190:Ppp2r3a UTSW 9 101212527 missense probably benign 0.11
R7288:Ppp2r3a UTSW 9 101127004 missense probably damaging 0.98
R7292:Ppp2r3a UTSW 9 101212672 missense probably damaging 0.96
R7512:Ppp2r3a UTSW 9 101175333 missense possibly damaging 0.69
X0020:Ppp2r3a UTSW 9 101212039 missense probably benign 0.19
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-06-22