Incidental Mutation 'R6574:Flt4'
ID523359
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49625372 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 101 (T101A)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect probably benign
Transcript: ENSMUST00000020617
AA Change: T101A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: T101A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152253
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTCCTTGGAGGCTTGGGTAAAATC -3'
(R):5'- GTATTCACTCCTGCTAGCCTGG -3'

Sequencing Primer
(F):5'- AGGTAGGAGAGATCCTGACTTCTCC -3'
(R):5'- TGCTAGCCTGGGGTCAG -3'
Posted On2018-06-22