Incidental Mutation 'R6574:Pmp22'
ID523360
Institutional Source Beutler Lab
Gene Symbol Pmp22
Ensembl Gene ENSMUSG00000018217
Gene Nameperipheral myelin protein 22
SynonymsGas-3
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008885.2; MGI:97631

Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location63128982-63159547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63158273 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 114 (A114V)
Ref Sequence ENSEMBL: ENSMUSP00000104342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018361] [ENSMUST00000108700] [ENSMUST00000108701] [ENSMUST00000108702]
Predicted Effect probably damaging
Transcript: ENSMUST00000018361
AA Change: A114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018361
Gene: ENSMUSG00000018217
AA Change: A114V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108700
AA Change: A114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104340
Gene: ENSMUSG00000018217
AA Change: A114V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108701
AA Change: A114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104341
Gene: ENSMUSG00000018217
AA Change: A114V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.7e-50 PFAM
Pfam:Claudin_2 55 155 1.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108702
AA Change: A114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104342
Gene: ENSMUSG00000018217
AA Change: A114V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 2447704; 3614822
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice with one or two copies of several mutations exhibit tremors, a tendency toward seizures, and partial paralysis associated with demyelination and loss of peripheral axons. Mutants have high juvenile mortality and males are often sterile. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(4) Spontaneous(3) Chemically induced(4)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Pmp22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Pmp22 APN 11 63158308 missense probably benign
IGL02350:Pmp22 APN 11 63158308 missense probably benign
IGL02357:Pmp22 APN 11 63158308 missense probably benign
IGL02423:Pmp22 APN 11 63158292 missense possibly damaging 0.94
IGL03107:Pmp22 APN 11 63158309 missense probably benign
PIT4431001:Pmp22 UTSW 11 63151241 missense probably benign 0.00
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0453:Pmp22 UTSW 11 63151103 intron probably benign
R0561:Pmp22 UTSW 11 63134424 missense probably damaging 1.00
R3858:Pmp22 UTSW 11 63134475 missense probably benign 0.00
R5107:Pmp22 UTSW 11 63158411 missense probably damaging 0.99
R6573:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6575:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTGGACCCTCAGAGAG -3'
(R):5'- TATGCGCGCTCAGAGCCTA -3'

Sequencing Primer
(F):5'- CTCAGAGAGGGGCGTTGG -3'
(R):5'- TCAGAGCCTAGACGGACG -3'
Posted On2018-06-22