Incidental Mutation 'R6574:Tcrg-C3'
ID523364
Institutional Source Beutler Lab
Gene Symbol Tcrg-C3
Ensembl Gene ENSMUSG00000091682
Gene NameT cell receptor gamma, constant 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location19260885-19263397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19261123 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 80 (R80S)
Ref Sequence ENSEMBL: ENSMUSP00000132340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164407]
Predicted Effect probably benign
Transcript: ENSMUST00000103562
Predicted Effect probably benign
Transcript: ENSMUST00000164407
AA Change: R80S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000132340
Gene: ENSMUSG00000091682
AA Change: R80S

DomainStartEndE-ValueType
IGc1 27 98 1.01e-17 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000198163
AA Change: R79S
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Tcrg-C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4449001:Tcrg-C3 UTSW 13 19263362 nonsense probably null
R0498:Tcrg-C3 UTSW 13 19261092 missense probably damaging 1.00
R1322:Tcrg-C3 UTSW 13 19261194 missense probably benign 0.26
R1834:Tcrg-C3 UTSW 13 19263365 missense possibly damaging 0.50
R1852:Tcrg-C3 UTSW 13 19261091 missense probably damaging 1.00
R1987:Tcrg-C3 UTSW 13 19260994 missense probably damaging 1.00
R1988:Tcrg-C3 UTSW 13 19260994 missense probably damaging 1.00
R6086:Tcrg-C3 UTSW 13 19263284 missense probably damaging 1.00
R7209:Tcrg-C3 UTSW 13 19261164 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCTCCATAAGACTGGGACATACC -3'
(R):5'- CCTCAGCCAACCTAGTACTATGG -3'

Sequencing Primer
(F):5'- CCATAAGACTGGGACATACCTTTGTG -3'
(R):5'- GCAATGGCCCCAATTAAATGTC -3'
Posted On2018-06-22