Incidental Mutation 'R6574:Eif4e1b'
ID523365
Institutional Source Beutler Lab
Gene Symbol Eif4e1b
Ensembl Gene ENSMUSG00000074895
Gene Nameeukaryotic translation initiation factor 4E family member 1B
SynonymsEif4eloo
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location54783998-54788459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54784898 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 100 (F100S)
Ref Sequence ENSEMBL: ENSMUSP00000120619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026993] [ENSMUST00000099503] [ENSMUST00000110003] [ENSMUST00000126525] [ENSMUST00000126785] [ENSMUST00000131692] [ENSMUST00000132005] [ENSMUST00000132415] [ENSMUST00000132728] [ENSMUST00000139184] [ENSMUST00000141398] [ENSMUST00000142158] [ENSMUST00000152204] [ENSMUST00000163796] [ENSMUST00000163915]
Predicted Effect probably benign
Transcript: ENSMUST00000026993
SMART Domains Protein: ENSMUSP00000026993
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 263 6.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099503
SMART Domains Protein: ENSMUSP00000097102
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 266 1.3e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110003
AA Change: F100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105630
Gene: ENSMUSG00000074895
AA Change: F100S

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 227 2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124055
Predicted Effect probably damaging
Transcript: ENSMUST00000126525
AA Change: F96S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121625
Gene: ENSMUSG00000074895
AA Change: F96S

DomainStartEndE-ValueType
Pfam:IF4E 63 111 3.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126785
AA Change: F106S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118697
Gene: ENSMUSG00000074895
AA Change: F106S

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Pfam:IF4E 72 234 1.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131692
SMART Domains Protein: ENSMUSP00000115287
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 263 8.9e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132005
AA Change: F105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116681
Gene: ENSMUSG00000074895
AA Change: F105S

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:IF4E 71 175 3e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132415
AA Change: F96S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120733
Gene: ENSMUSG00000074895
AA Change: F96S

DomainStartEndE-ValueType
Pfam:IF4E 63 162 1.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132728
AA Change: F100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123294
Gene: ENSMUSG00000074895
AA Change: F100S

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 228 4.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139184
AA Change: F100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119305
Gene: ENSMUSG00000074895
AA Change: F100S

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 134 4.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141398
SMART Domains Protein: ENSMUSP00000114217
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
Pfam:IF4E 1 90 6.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142158
AA Change: F105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117092
Gene: ENSMUSG00000074895
AA Change: F105S

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:IF4E 71 233 4.8e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152204
AA Change: F100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120619
Gene: ENSMUSG00000074895
AA Change: F100S

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 170 9.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163796
SMART Domains Protein: ENSMUSP00000131671
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 13 193 4.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163915
SMART Domains Protein: ENSMUSP00000130765
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 13 143 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171859
SMART Domains Protein: ENSMUSP00000128568
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 79 3.6e-17 PFAM
Pfam:Tetraspannin 78 144 1.5e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Eif4e1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Eif4e1b APN 13 54786916 missense probably damaging 1.00
R1766:Eif4e1b UTSW 13 54786891 missense probably damaging 0.98
R1858:Eif4e1b UTSW 13 54787278 unclassified probably null
R4130:Eif4e1b UTSW 13 54787317 missense probably benign 0.25
R4426:Eif4e1b UTSW 13 54784483 missense probably benign 0.01
R4702:Eif4e1b UTSW 13 54787325 missense probably damaging 0.99
R5367:Eif4e1b UTSW 13 54786944 missense probably damaging 0.99
R5595:Eif4e1b UTSW 13 54786716 missense possibly damaging 0.49
R5976:Eif4e1b UTSW 13 54784822 missense probably damaging 1.00
R6195:Eif4e1b UTSW 13 54784205 missense probably null 0.13
R6610:Eif4e1b UTSW 13 54784315 intron probably benign
R6980:Eif4e1b UTSW 13 54784103 critical splice donor site probably null
R7131:Eif4e1b UTSW 13 54784100 missense probably null 0.97
R7349:Eif4e1b UTSW 13 54784193 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATTGCGTGTCCCAGATCTCAC -3'
(R):5'- ACAAAGCCACAGAGTCTCGG -3'

Sequencing Primer
(F):5'- CCTCCTACTTTACAAACATGGCAG -3'
(R):5'- GCTTCTTCCAGACCCCAGG -3'
Posted On2018-06-22