Incidental Mutation 'R6574:Ccno'
ID523366
Institutional Source Beutler Lab
Gene Symbol Ccno
Ensembl Gene ENSMUSG00000042417
Gene Namecyclin O
SynonymsUng2, Ccnu
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location112987802-112990777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112988185 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 96 (D96E)
Ref Sequence ENSEMBL: ENSMUSP00000040083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038404]
Predicted Effect probably benign
Transcript: ENSMUST00000038404
AA Change: D96E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000040083
Gene: ENSMUSG00000042417
AA Change: D96E

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
CYCLIN 140 224 1.23e-19 SMART
Cyclin_C 233 350 3.49e-7 SMART
CYCLIN 244 327 5.77e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225555
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin protein family, and the encoded protein is involved in regulation of the cell cycle. Disruption of this gene is associated with primary ciliary dyskinesia-19. Alternative splicing results in multiple transcript variants. This gene, which has a previous symbol of UNG2, was erroneously identified as a uracil DNA glycosylase in PubMed ID: 2001396. A later publication, PubMed ID: 8419333, identified this gene's product as a cyclin protein family member. The UNG2 symbol is also used as a specific protein isoform name for the UNG gene (GeneID 7374), so confusion exists in the scientific literature and in some databases for these two genes. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit pre-weaning lethality after E17, hydrocephaly, growth retardation, enlarged brain ventricles, thin cerebral cortex, nasal cavity congestion and impaired formation of deuterosomes and centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Ccno
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Ccno APN 13 112989027 missense probably damaging 1.00
IGL02875:Ccno APN 13 112988052 missense possibly damaging 0.91
R0193:Ccno UTSW 13 112988884 unclassified probably benign
R0329:Ccno UTSW 13 112989996 missense probably damaging 1.00
R0330:Ccno UTSW 13 112989996 missense probably damaging 1.00
R0387:Ccno UTSW 13 112989867 missense probably damaging 1.00
R0556:Ccno UTSW 13 112988286 critical splice donor site probably null
R4197:Ccno UTSW 13 112989069 missense probably damaging 0.99
R4683:Ccno UTSW 13 112989009 unclassified probably null
R4825:Ccno UTSW 13 112988099 missense probably benign 0.14
R6180:Ccno UTSW 13 112989845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACATGGTTACCCCTTGCCC -3'
(R):5'- ATGACTAGGGCTGTGCGAAG -3'

Sequencing Primer
(F):5'- TGCCTCCGGAGAAAGAAGCC -3'
(R):5'- AGCCAGCAGCCATGGAG -3'
Posted On2018-06-22