Incidental Mutation 'R6581:Or2f1'
ID 523432
Institutional Source Beutler Lab
Gene Symbol Or2f1
Ensembl Gene ENSMUSG00000095831
Gene Name olfactory receptor family 2 subfamily F member 1
Synonyms MOR257-8P, Olfr453, GA_x6K02T2P3E9-4815856-4814903
MMRRC Submission 044705-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R6581 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42720973-42721926 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42721013 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 14 (L14P)
Ref Sequence ENSEMBL: ENSMUSP00000150467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053647] [ENSMUST00000213997]
AlphaFold Q7TRV7
Predicted Effect probably damaging
Transcript: ENSMUST00000053647
AA Change: L14P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052043
Gene: ENSMUSG00000095831
AA Change: L14P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-54 PFAM
Pfam:7tm_1 41 290 1.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203812
Predicted Effect probably damaging
Transcript: ENSMUST00000213997
AA Change: L14P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,256,741 (GRCm39) V51M probably damaging Het
Cdh17 A T 4: 11,799,615 (GRCm39) I471F probably damaging Het
Dnajb7 T A 15: 81,292,226 (GRCm39) E37V probably damaging Het
Dpy19l1 T A 9: 24,359,160 (GRCm39) I337F possibly damaging Het
Etv5 C T 16: 22,258,449 (GRCm39) probably benign Het
Gbp2b T A 3: 142,313,999 (GRCm39) Y426* probably null Het
Gm21103 A T 14: 17,484,809 (GRCm39) N78K probably damaging Het
Helz2 A G 2: 180,871,172 (GRCm39) V2755A probably damaging Het
Itga9 A T 9: 118,487,632 (GRCm39) E238D probably benign Het
Itgb8 A T 12: 119,126,950 (GRCm39) C736S probably benign Het
Luzp1 A G 4: 136,267,942 (GRCm39) E55G probably damaging Het
Mrtfa A G 15: 80,900,574 (GRCm39) L589P probably damaging Het
Ms4a4d G A 19: 11,532,204 (GRCm39) V117M probably damaging Het
Odad2 C T 18: 7,129,560 (GRCm39) V873I possibly damaging Het
Or3a1d A G 11: 74,238,032 (GRCm39) F126S probably damaging Het
Or52a5b T C 7: 103,417,428 (GRCm39) I59V probably benign Het
Prl7a1 A T 13: 27,817,612 (GRCm39) D217E probably damaging Het
Slc12a5 T C 2: 164,829,035 (GRCm39) F525S probably damaging Het
Smyd5 G A 6: 85,409,005 (GRCm39) D7N probably damaging Het
Spata18 G T 5: 73,826,859 (GRCm39) R152L probably benign Het
Thbd A G 2: 148,248,192 (GRCm39) S559P probably benign Het
Tiam2 CGGG CGGGG 17: 3,464,897 (GRCm39) probably null Het
Tnpo2 C A 8: 85,782,033 (GRCm39) P874Q probably damaging Het
Uchl4 A T 9: 64,143,075 (GRCm39) E185D possibly damaging Het
Vmn1r158 G A 7: 22,489,465 (GRCm39) T248I possibly damaging Het
Vmn1r5 T C 6: 56,962,366 (GRCm39) F14L probably benign Het
Yaf2 T C 15: 93,184,295 (GRCm39) T101A probably benign Het
Other mutations in Or2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Or2f1 APN 6 42,721,625 (GRCm39) missense probably damaging 1.00
IGL01642:Or2f1 APN 6 42,721,486 (GRCm39) missense probably benign 0.00
IGL02703:Or2f1 APN 6 42,721,010 (GRCm39) missense possibly damaging 0.90
IGL03018:Or2f1 APN 6 42,721,748 (GRCm39) missense probably damaging 1.00
R1163:Or2f1 UTSW 6 42,721,057 (GRCm39) missense probably benign 0.00
R1728:Or2f1 UTSW 6 42,721,069 (GRCm39) missense possibly damaging 0.61
R1729:Or2f1 UTSW 6 42,721,069 (GRCm39) missense possibly damaging 0.61
R1730:Or2f1 UTSW 6 42,721,069 (GRCm39) missense possibly damaging 0.61
R1739:Or2f1 UTSW 6 42,721,069 (GRCm39) missense possibly damaging 0.61
R1784:Or2f1 UTSW 6 42,721,069 (GRCm39) missense possibly damaging 0.61
R2014:Or2f1 UTSW 6 42,721,784 (GRCm39) missense probably damaging 0.99
R2015:Or2f1 UTSW 6 42,721,784 (GRCm39) missense probably damaging 0.99
R2130:Or2f1 UTSW 6 42,721,069 (GRCm39) missense possibly damaging 0.61
R2132:Or2f1 UTSW 6 42,721,069 (GRCm39) missense possibly damaging 0.61
R2133:Or2f1 UTSW 6 42,721,069 (GRCm39) missense possibly damaging 0.61
R3937:Or2f1 UTSW 6 42,721,010 (GRCm39) missense probably damaging 0.98
R4862:Or2f1 UTSW 6 42,721,489 (GRCm39) missense possibly damaging 0.65
R4959:Or2f1 UTSW 6 42,721,621 (GRCm39) missense probably damaging 1.00
R4973:Or2f1 UTSW 6 42,721,621 (GRCm39) missense probably damaging 1.00
R5155:Or2f1 UTSW 6 42,721,748 (GRCm39) missense probably damaging 1.00
R7028:Or2f1 UTSW 6 42,721,337 (GRCm39) missense probably benign 0.08
R7348:Or2f1 UTSW 6 42,721,790 (GRCm39) missense possibly damaging 0.95
R7490:Or2f1 UTSW 6 42,721,739 (GRCm39) missense probably damaging 1.00
R7522:Or2f1 UTSW 6 42,721,568 (GRCm39) missense probably damaging 0.98
R8373:Or2f1 UTSW 6 42,721,280 (GRCm39) missense probably damaging 0.99
R9224:Or2f1 UTSW 6 42,721,904 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CAAAGCACACTGGGATCAGG -3'
(R):5'- TGCACAGCTCAGAAATGGG -3'

Sequencing Primer
(F):5'- GTCCATCGTGATTCAAAGCG -3'
(R):5'- CACAGCTCAGAAATGGGATTGTTTTG -3'
Posted On 2018-06-22