Incidental Mutation 'R6581:Aldh8a1'
ID523441
Institutional Source Beutler Lab
Gene Symbol Aldh8a1
Ensembl Gene ENSMUSG00000037542
Gene Namealdehyde dehydrogenase 8 family, member A1
SynonymsRALDH4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6581 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location21377291-21396585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21380842 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 51 (V51M)
Ref Sequence ENSEMBL: ENSMUSP00000038878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042699]
Predicted Effect probably damaging
Transcript: ENSMUST00000042699
AA Change: V51M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038878
Gene: ENSMUSG00000037542
AA Change: V51M

DomainStartEndE-ValueType
Pfam:Aldedh 19 483 8.6e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159163
SMART Domains Protein: ENSMUSP00000124448
Gene: ENSMUSG00000037542

DomainStartEndE-ValueType
Pfam:Aldedh 16 205 1.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161285
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. It plays a role in a pathway of 9-cis-retinoic acid biosynthesis in vivo. This enzyme converts 9-cis-retinal into the retinoid X receptor ligand 9-cis-retinoic acid, and has approximately 40-fold higher activity with 9-cis-retinal than with all-trans-retinal. Therefore, it is the first known aldehyde dehydrogenase to show a preference for 9-cis-retinal relative to all-trans-retinal. Three transcript variants encoding distinct protein isoforms have been identified for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc4 C T 18: 7,129,560 V873I possibly damaging Het
Cdh17 A T 4: 11,799,615 I471F probably damaging Het
Dnajb7 T A 15: 81,408,025 E37V probably damaging Het
Dpy19l1 T A 9: 24,447,864 I337F possibly damaging Het
Etv5 C T 16: 22,439,699 probably benign Het
Gbp2b T A 3: 142,608,238 Y426* probably null Het
Gm21103 A T 14: 6,303,815 N78K probably damaging Het
Helz2 A G 2: 181,229,379 V2755A probably damaging Het
Itga9 A T 9: 118,658,564 E238D probably benign Het
Itgb8 A T 12: 119,163,215 C736S probably benign Het
Luzp1 A G 4: 136,540,631 E55G probably damaging Het
Mkl1 A G 15: 81,016,373 L589P probably damaging Het
Ms4a4d G A 19: 11,554,840 V117M probably damaging Het
Olfr411 A G 11: 74,347,206 F126S probably damaging Het
Olfr453 T C 6: 42,744,079 L14P probably damaging Het
Olfr69 T C 7: 103,768,221 I59V probably benign Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Slc12a5 T C 2: 164,987,115 F525S probably damaging Het
Smyd5 G A 6: 85,432,023 D7N probably damaging Het
Spata18 G T 5: 73,669,516 R152L probably benign Het
Thbd A G 2: 148,406,272 S559P probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnpo2 C A 8: 85,055,404 P874Q probably damaging Het
Uchl4 A T 9: 64,235,793 E185D possibly damaging Het
Vmn1r158 G A 7: 22,790,040 T248I possibly damaging Het
Vmn1r5 T C 6: 56,985,381 F14L probably benign Het
Yaf2 T C 15: 93,286,414 T101A probably benign Het
Other mutations in Aldh8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Aldh8a1 APN 10 21395430 missense probably damaging 0.98
IGL01095:Aldh8a1 APN 10 21389281 missense probably benign 0.18
IGL01525:Aldh8a1 APN 10 21391573 missense probably damaging 0.98
IGL02206:Aldh8a1 APN 10 21395575 missense probably benign 0.00
IGL02232:Aldh8a1 APN 10 21395646 missense probably damaging 1.00
IGL03213:Aldh8a1 APN 10 21384717 missense probably damaging 0.97
R0105:Aldh8a1 UTSW 10 21395539 missense probably damaging 0.99
R0105:Aldh8a1 UTSW 10 21395539 missense probably damaging 0.99
R0893:Aldh8a1 UTSW 10 21391694 missense probably benign 0.19
R1168:Aldh8a1 UTSW 10 21384631 splice site probably null
R1764:Aldh8a1 UTSW 10 21395493 missense probably benign 0.01
R4016:Aldh8a1 UTSW 10 21395571 missense probably benign 0.00
R4464:Aldh8a1 UTSW 10 21388941 intron probably benign
R4915:Aldh8a1 UTSW 10 21395763 missense probably damaging 1.00
R5816:Aldh8a1 UTSW 10 21395430 missense probably damaging 0.98
R6032:Aldh8a1 UTSW 10 21389071 missense probably benign 0.29
R6032:Aldh8a1 UTSW 10 21389071 missense probably benign 0.29
R7422:Aldh8a1 UTSW 10 21389097 missense possibly damaging 0.74
R7458:Aldh8a1 UTSW 10 21395593 missense possibly damaging 0.95
X0011:Aldh8a1 UTSW 10 21389239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGGTTCCACGAGCACTG -3'
(R):5'- AGCATCTGGTAAGACACACCTG -3'

Sequencing Primer
(F):5'- AGCACTGCCGTGTCGTC -3'
(R):5'- ACCCCTGTTGGTGAAAGATC -3'
Posted On2018-06-22