Incidental Mutation 'R6593:Clca3a2'
ID523461
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Namechloride channel accessory 3A2
SynonymsClca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6593 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location144796559-144819494 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 144808577 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
Predicted Effect probably null
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198543
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 unclassified probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTATTTGCGTAACCATGGAGAC -3'
(R):5'- TCCAGTGACCAGAGCACTTC -3'

Sequencing Primer
(F):5'- CAGAGCATCTGTTTAGTGCAATG -3'
(R):5'- AGAGCACTTCCGGTTCTGAGATC -3'
Posted On2018-06-22