Incidental Mutation 'R6593:Rasef'
ID 523465
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene Name RAS and EF hand domain containing
Synonyms RAB45
MMRRC Submission 044717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R6593 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 73632816-73709231 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 73663327 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 167 (H167N)
Ref Sequence ENSEMBL: ENSMUSP00000099901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
AlphaFold Q5RI75
Predicted Effect probably damaging
Transcript: ENSMUST00000058292
AA Change: H239N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: H239N

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102837
AA Change: H167N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: H167N

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000222414
AA Change: H320N

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,903,491 (GRCm39) N1047K probably benign Het
AI597479 C A 1: 43,150,408 (GRCm39) Q173K probably damaging Het
Arhgef10 T C 8: 15,012,522 (GRCm39) L282P probably damaging Het
Arhgef10 T C 8: 15,012,564 (GRCm39) I296T possibly damaging Het
Atg2b A G 12: 105,611,107 (GRCm39) S1275P probably damaging Het
Cep290 T C 10: 100,344,638 (GRCm39) M485T probably benign Het
Clca3a2 A G 3: 144,514,338 (GRCm39) probably null Het
Clcn6 C T 4: 148,095,226 (GRCm39) S731N probably benign Het
Clic6 A G 16: 92,325,005 (GRCm39) I388V possibly damaging Het
Cpsf4l G T 11: 113,600,192 (GRCm39) probably benign Het
Dlg5 G A 14: 24,200,720 (GRCm39) H1350Y probably benign Het
Dnase2b T C 3: 146,292,666 (GRCm39) Y169C probably damaging Het
Elavl3 C T 9: 21,929,843 (GRCm39) V354M possibly damaging Het
Farp2 A C 1: 93,497,662 (GRCm39) I231L possibly damaging Het
Gcc2 T A 10: 58,107,329 (GRCm39) M755K probably damaging Het
Gpr88 T C 3: 116,046,273 (GRCm39) T13A unknown Het
Gstm3 T A 3: 107,875,511 (GRCm39) N40Y probably benign Het
Krtap5-2 A T 7: 141,728,697 (GRCm39) C328S unknown Het
Lpar1 A T 4: 58,486,605 (GRCm39) V222E probably damaging Het
Neto2 A G 8: 86,396,175 (GRCm39) S192P probably damaging Het
Odad1 T A 7: 45,596,808 (GRCm39) D378E probably damaging Het
Or52n3 C T 7: 104,530,640 (GRCm39) T242I probably damaging Het
Pcdhgb1 G T 18: 37,815,134 (GRCm39) D542Y probably damaging Het
Phldb2 G A 16: 45,645,790 (GRCm39) Q264* probably null Het
Ptgs2 G A 1: 149,976,784 (GRCm39) D6N possibly damaging Het
Rbbp4 A G 4: 129,216,168 (GRCm39) L193S probably damaging Het
Rigi T C 4: 40,226,651 (GRCm39) I169V probably benign Het
Sec24d T C 3: 123,147,061 (GRCm39) F673S probably damaging Het
Slc9b1 T C 3: 135,063,219 (GRCm39) M1T probably null Het
Stra6 A G 9: 58,059,262 (GRCm39) T542A probably benign Het
Stt3b T C 9: 115,081,579 (GRCm39) Y569C probably damaging Het
Traf3ip1 A G 1: 91,455,417 (GRCm39) K626R possibly damaging Het
Washc2 T A 6: 116,236,210 (GRCm39) I1227N probably damaging Het
Xpo7 G A 14: 70,919,802 (GRCm39) A671V probably damaging Het
Zfp799 A G 17: 33,038,764 (GRCm39) Y501H probably damaging Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73,689,662 (GRCm39) nonsense probably null
IGL01329:Rasef APN 4 73,645,882 (GRCm39) missense probably damaging 1.00
IGL01517:Rasef APN 4 73,688,059 (GRCm39) missense probably benign 0.03
IGL02465:Rasef APN 4 73,652,725 (GRCm39) missense probably damaging 1.00
IGL02676:Rasef APN 4 73,677,966 (GRCm39) missense possibly damaging 0.69
IGL03137:Rasef APN 4 73,652,720 (GRCm39) nonsense probably null
IGL03403:Rasef APN 4 73,652,771 (GRCm39) missense probably damaging 1.00
BB001:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
BB011:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
P0033:Rasef UTSW 4 73,668,089 (GRCm39) missense probably benign 0.26
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0317:Rasef UTSW 4 73,666,799 (GRCm39) missense probably damaging 1.00
R0686:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R0987:Rasef UTSW 4 73,652,721 (GRCm39) nonsense probably null
R1115:Rasef UTSW 4 73,666,841 (GRCm39) missense possibly damaging 0.85
R1511:Rasef UTSW 4 73,653,985 (GRCm39) missense probably damaging 1.00
R1585:Rasef UTSW 4 73,658,574 (GRCm39) missense probably damaging 1.00
R1646:Rasef UTSW 4 73,652,786 (GRCm39) missense probably damaging 1.00
R1705:Rasef UTSW 4 73,662,301 (GRCm39) nonsense probably null
R1918:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R1919:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R3819:Rasef UTSW 4 73,677,942 (GRCm39) missense probably damaging 1.00
R3891:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R3892:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R4344:Rasef UTSW 4 73,663,326 (GRCm39) missense probably damaging 1.00
R4491:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4492:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4594:Rasef UTSW 4 73,698,626 (GRCm39) missense possibly damaging 0.47
R4915:Rasef UTSW 4 73,649,696 (GRCm39) missense probably damaging 1.00
R5276:Rasef UTSW 4 73,654,004 (GRCm39) missense probably null 1.00
R5359:Rasef UTSW 4 73,689,565 (GRCm39) missense probably damaging 1.00
R5682:Rasef UTSW 4 73,659,208 (GRCm39) nonsense probably null
R5693:Rasef UTSW 4 73,688,076 (GRCm39) missense probably damaging 0.99
R6414:Rasef UTSW 4 73,658,818 (GRCm39) missense probably benign 0.13
R6543:Rasef UTSW 4 73,698,756 (GRCm39) intron probably benign
R7078:Rasef UTSW 4 73,698,626 (GRCm39) missense probably benign 0.01
R7083:Rasef UTSW 4 73,709,221 (GRCm39) missense probably benign 0.26
R7106:Rasef UTSW 4 73,645,864 (GRCm39) missense probably damaging 1.00
R7127:Rasef UTSW 4 73,662,369 (GRCm39) missense probably damaging 1.00
R7329:Rasef UTSW 4 73,662,374 (GRCm39) missense probably damaging 1.00
R7767:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R7891:Rasef UTSW 4 73,709,201 (GRCm39) missense probably benign
R7891:Rasef UTSW 4 73,677,935 (GRCm39) missense probably benign 0.00
R7924:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
R7997:Rasef UTSW 4 73,658,799 (GRCm39) missense possibly damaging 0.78
R8554:Rasef UTSW 4 73,645,844 (GRCm39) missense probably benign 0.03
R8832:Rasef UTSW 4 73,698,558 (GRCm39) intron probably benign
R8850:Rasef UTSW 4 73,645,840 (GRCm39) missense probably damaging 1.00
R8985:Rasef UTSW 4 73,708,960 (GRCm39) missense possibly damaging 0.48
R9093:Rasef UTSW 4 73,698,583 (GRCm39) missense probably benign 0.00
R9179:Rasef UTSW 4 73,662,356 (GRCm39) missense probably damaging 0.97
R9199:Rasef UTSW 4 73,658,625 (GRCm39) missense possibly damaging 0.88
R9300:Rasef UTSW 4 73,659,393 (GRCm39) missense probably benign
R9310:Rasef UTSW 4 73,653,956 (GRCm39) critical splice donor site probably null
R9415:Rasef UTSW 4 73,645,882 (GRCm39) missense probably benign 0.00
R9482:Rasef UTSW 4 73,708,933 (GRCm39) missense probably benign 0.00
R9719:Rasef UTSW 4 73,688,102 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAGTCACACATTTGGCATCTTTCC -3'
(R):5'- GCTCCCAGATTGTCAGGAAAGC -3'

Sequencing Primer
(F):5'- CATTTCTTTATACAAATGGGCAGACC -3'
(R):5'- GATTGTCAGGAAAGCAAACTAATTC -3'
Posted On 2018-06-22