Incidental Mutation 'R6593:Rbbp4'
ID523466
Institutional Source Beutler Lab
Gene Symbol Rbbp4
Ensembl Gene ENSMUSG00000057236
Gene Nameretinoblastoma binding protein 4, chromatin remodeling factor
SynonymsCAF-1 p48 subunit, RBAP48
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6593 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129307100-129335370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129322375 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 193 (L193S)
Ref Sequence ENSEMBL: ENSMUSP00000099658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102598]
Predicted Effect probably damaging
Transcript: ENSMUST00000102598
AA Change: L193S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099658
Gene: ENSMUSG00000057236
AA Change: L193S

DomainStartEndE-ValueType
Pfam:CAF1C_H4-bd 19 88 1.3e-28 PFAM
WD40 112 153 8.25e0 SMART
WD40 166 206 2.07e-6 SMART
WD40 216 256 4.48e-2 SMART
WD40 262 302 5.81e-10 SMART
WD40 306 346 3.93e-7 SMART
WD40 363 403 1.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181237
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. It is present in protein complexes involved in histone acetylation and chromatin assembly. It is part of the Mi-2 complex which has been implicated in chromatin remodeling and transcriptional repression associated with histone deacetylation. This encoded protein is also part of co-repressor complexes, which is an integral component of transcriptional silencing. It is found among several cellular proteins that bind directly to retinoblastoma protein to regulate cell proliferation. This protein also seems to be involved in transcriptional repression of E2F-responsive genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Rbbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rbbp4 APN 4 129310153 missense probably benign 0.06
IGL01150:Rbbp4 APN 4 129322875 splice site probably benign
IGL02228:Rbbp4 APN 4 129317750 missense probably damaging 1.00
R0864:Rbbp4 UTSW 4 129320551 splice site probably benign
R1056:Rbbp4 UTSW 4 129317649 missense probably damaging 0.99
R3717:Rbbp4 UTSW 4 129328632 missense probably benign 0.02
R3762:Rbbp4 UTSW 4 129334551 missense probably damaging 1.00
R6148:Rbbp4 UTSW 4 129321958 missense probably benign
R6676:Rbbp4 UTSW 4 129328621 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTTGGAACTGCACTGATGTCC -3'
(R):5'- ATCGTGATTGCTCAGCTTTAGC -3'

Sequencing Primer
(F):5'- TCCCACAGGCAGATGGTCTTAAATG -3'
(R):5'- AGCGTTATATATCTGGTAAAGGGTC -3'
Posted On2018-06-22